Incidental Mutation 'R5234:Tnrc6c'
ID398234
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Nametrinucleotide repeat containing 6C
Synonyms9930033H14Rik
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5234 (G1)
Quality Score152
Status Not validated
Chromosome11
Chromosomal Location117654289-117763439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117760729 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1693 (V1693F)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
Predicted Effect probably benign
Transcript: ENSMUST00000026658
AA Change: V1861F

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: V1861F

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106344
AA Change: V1861F

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: V1861F

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138299
AA Change: V1693F

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: V1693F

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117720951 missense possibly damaging 0.46
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAGTGAACCGGTTCCTGG -3'
(R):5'- TCATCTTCAGACTGGACAGAGG -3'

Sequencing Primer
(F):5'- AACCGGTTCCTGGCCCAAG -3'
(R):5'- TACTCCAAGGGGCAGCTTGTC -3'
Posted On2016-07-06