Incidental Mutation 'R5234:Fut8'
ID398236
Institutional Source Beutler Lab
Gene Symbol Fut8
Ensembl Gene ENSMUSG00000021065
Gene Namefucosyltransferase 8
Synonymsalpha (1,6) fucosyltransferase
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location77238125-77476338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77332230 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 35 (H35R)
Ref Sequence ENSEMBL: ENSMUSP00000136327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062804] [ENSMUST00000171770] [ENSMUST00000177595]
Predicted Effect probably benign
Transcript: ENSMUST00000062804
AA Change: H35R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054530
Gene: ENSMUSG00000021065
AA Change: H35R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171770
AA Change: H35R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130845
Gene: ENSMUSG00000021065
AA Change: H35R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177595
AA Change: H35R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136327
Gene: ENSMUSG00000021065
AA Change: H35R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217879
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme belonging to the family of fucosyltransferases. The product of this gene catalyzes the transfer of fucose from GDP-fucose to N-linked type complex glycopeptides. This enzyme is distinct from other fucosyltransferases which catalyze alpha1-2, alpha1-3, and alpha1-4 fucose addition. The expression of this gene may contribute to the malignancy of cancer cells and to their invasive and metastatic capabilities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mutation of this gene results in partial postnatal lethality, growth retardation, and progressive emphysema-like changes that include enlarged alveoli, increased lung capacity and compliance, and alveolar cell apoptosis. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Fut8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Fut8 APN 12 77448488 missense probably benign
IGL00841:Fut8 APN 12 77365321 missense probably benign
IGL01660:Fut8 APN 12 77450258 nonsense probably null
IGL02330:Fut8 APN 12 77450243 missense probably damaging 1.00
IGL02815:Fut8 APN 12 77365083 missense probably benign
IGL02836:Fut8 APN 12 77450213 missense probably benign 0.24
IGL02981:Fut8 APN 12 77475038 missense probably damaging 1.00
IGL03328:Fut8 APN 12 77365229 missense probably damaging 0.99
Seaweed UTSW 12 77475315 makesense probably null
R0001:Fut8 UTSW 12 77475315 makesense probably null
R0037:Fut8 UTSW 12 77365037 missense probably benign
R0115:Fut8 UTSW 12 77448560 missense probably damaging 1.00
R0334:Fut8 UTSW 12 77393762 missense possibly damaging 0.95
R0481:Fut8 UTSW 12 77448560 missense probably damaging 1.00
R0554:Fut8 UTSW 12 77364970 missense probably benign 0.00
R0671:Fut8 UTSW 12 77475017 missense probably damaging 1.00
R1491:Fut8 UTSW 12 77448674 missense possibly damaging 0.50
R1918:Fut8 UTSW 12 77332218 missense probably benign 0.25
R2336:Fut8 UTSW 12 77412956 splice site probably benign
R2975:Fut8 UTSW 12 77365013 missense probably benign 0.20
R3933:Fut8 UTSW 12 77475259 missense probably damaging 1.00
R4066:Fut8 UTSW 12 77464061 missense probably damaging 1.00
R4067:Fut8 UTSW 12 77464061 missense probably damaging 1.00
R4159:Fut8 UTSW 12 77393749 missense probably damaging 0.98
R4728:Fut8 UTSW 12 77475199 missense probably damaging 1.00
R4768:Fut8 UTSW 12 77365280 missense probably benign 0.12
R4831:Fut8 UTSW 12 77393829 missense probably damaging 0.99
R4914:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4915:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4917:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4918:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R5143:Fut8 UTSW 12 77365209 missense probably benign 0.07
R5973:Fut8 UTSW 12 77364997 missense probably benign
R6103:Fut8 UTSW 12 77331947 start gained probably benign
R7167:Fut8 UTSW 12 77448632 missense possibly damaging 0.94
R7498:Fut8 UTSW 12 77412934 missense probably benign 0.00
R7536:Fut8 UTSW 12 77475078 missense probably damaging 1.00
X0065:Fut8 UTSW 12 77448521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAACTAGAACCAGAGTACAATG -3'
(R):5'- CAACTGAAGCACTGTTCTATTTAGC -3'

Sequencing Primer
(F):5'- GAACCAGAGTACAATGTTTCCAG -3'
(R):5'- TCATGACACTTTTTAAAGGACTGC -3'
Posted On2016-07-06