Incidental Mutation 'R5234:Fam71d'
ID398238
Institutional Source Beutler Lab
Gene Symbol Fam71d
Ensembl Gene ENSMUSG00000056987
Gene Namefamily with sequence similarity 71, member D
Synonyms
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location78691535-78734516 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 78715271 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 236 (Y236*)
Ref Sequence ENSEMBL: ENSMUSP00000151845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077968] [ENSMUST00000218697] [ENSMUST00000219507] [ENSMUST00000219551] [ENSMUST00000220101] [ENSMUST00000220396]
Predicted Effect probably null
Transcript: ENSMUST00000077968
AA Change: Y236*
SMART Domains Protein: ENSMUSP00000077119
Gene: ENSMUSG00000056987
AA Change: Y236*

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
Pfam:DUF3699 111 184 1.6e-25 PFAM
low complexity region 237 250 N/A INTRINSIC
low complexity region 265 284 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218697
Predicted Effect probably benign
Transcript: ENSMUST00000219507
Predicted Effect probably null
Transcript: ENSMUST00000219551
AA Change: Y236*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219572
Predicted Effect probably benign
Transcript: ENSMUST00000220101
Predicted Effect probably benign
Transcript: ENSMUST00000220212
Predicted Effect probably benign
Transcript: ENSMUST00000220396
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Fam71d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Fam71d APN 12 78734207 critical splice donor site probably null
IGL02738:Fam71d APN 12 78734215 splice site probably benign
R0760:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R1832:Fam71d UTSW 12 78715506 unclassified probably benign
R1833:Fam71d UTSW 12 78715506 unclassified probably benign
R4335:Fam71d UTSW 12 78712232 missense possibly damaging 0.77
R4437:Fam71d UTSW 12 78715050 missense probably damaging 1.00
R4850:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R5445:Fam71d UTSW 12 78715116 missense probably damaging 1.00
R5587:Fam71d UTSW 12 78715075 missense probably damaging 0.99
R5965:Fam71d UTSW 12 78710306 missense unknown
R5993:Fam71d UTSW 12 78715436 missense probably damaging 0.98
R6644:Fam71d UTSW 12 78715286 missense probably damaging 1.00
R6660:Fam71d UTSW 12 78715357 missense possibly damaging 0.88
R7052:Fam71d UTSW 12 78719402 missense probably benign 0.00
R7098:Fam71d UTSW 12 78719634 critical splice donor site probably null
R7189:Fam71d UTSW 12 78712208 missense probably benign 0.22
R7305:Fam71d UTSW 12 78715035 missense possibly damaging 0.85
R7578:Fam71d UTSW 12 78715501 critical splice donor site probably null
R7604:Fam71d UTSW 12 78715014 missense probably damaging 1.00
R7720:Fam71d UTSW 12 78712133 missense probably damaging 1.00
R7786:Fam71d UTSW 12 78719629 missense probably benign 0.18
R8008:Fam71d UTSW 12 78715043 missense probably benign 0.33
U24488:Fam71d UTSW 12 78715037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTTTCTCAGTGGGTAGACCTC -3'
(R):5'- GACCCCTGAGATGTTTGTGG -3'

Sequencing Primer
(F):5'- TCAGTGGGTAGACCTCATCCC -3'
(R):5'- GCCATTTTGACGTCTGAGAC -3'
Posted On2016-07-06