Incidental Mutation 'R0453:Jak2'
Institutional Source Beutler Lab
Gene Symbol Jak2
Ensembl Gene ENSMUSG00000024789
Gene NameJanus kinase 2
MMRRC Submission 038653-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0453 (G1)
Quality Score225
Status Validated
Chromosomal Location29251828-29313080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29311838 bp
Amino Acid Change Isoleucine to Threonine at position 1130 (I1130T)
Ref Sequence ENSEMBL: ENSMUSP00000064394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025705] [ENSMUST00000065796]
Predicted Effect probably benign
Transcript: ENSMUST00000025705
AA Change: I1130T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025705
Gene: ENSMUSG00000024789
AA Change: I1130T

B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065796
AA Change: I1130T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064394
Gene: ENSMUSG00000024789
AA Change: I1130T

B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations die during midgestation due to a failure of erythropoieses. Mice expressing a conditional allele activated in mammary tissue exhibit lactation deficiency due to impaired alveologenesis. Mice homozygous for a knock-in allele exhibit myeloproliferative neoplasm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,753,668 Y715C probably damaging Het
Acad10 T A 5: 121,627,382 K843* probably null Het
Adam26b T C 8: 43,520,350 I538M probably benign Het
Adamtsl1 T C 4: 86,232,615 Y337H probably damaging Het
Ak7 T C 12: 105,716,048 M156T probably damaging Het
Aldh3a1 A G 11: 61,215,512 M238V probably benign Het
Asic4 T A 1: 75,473,511 probably benign Het
AW551984 A G 9: 39,600,641 S25P probably damaging Het
Bbs7 T A 3: 36,607,669 Y127F possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bco1 G A 8: 117,108,777 E156K possibly damaging Het
Becn1 T C 11: 101,290,449 D342G probably damaging Het
Birc6 T A 17: 74,649,754 I3575N probably damaging Het
Cc2d2a A T 5: 43,703,294 M522L probably benign Het
Cerkl A G 2: 79,342,451 F293L probably benign Het
Chil3 T G 3: 106,148,905 N311T probably benign Het
Cpeb2 T A 5: 43,285,713 probably benign Het
Cpxm2 A G 7: 132,128,405 S162P probably damaging Het
Cracr2b A C 7: 141,464,263 E136A probably damaging Het
Cyp2a4 T A 7: 26,312,833 M347K probably benign Het
Dicer1 C A 12: 104,702,630 R1264S probably benign Het
Dlgap1 T A 17: 70,761,346 N609K probably benign Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egfl8 T C 17: 34,614,882 Y74C probably damaging Het
Esyt1 A G 10: 128,512,209 S901P probably benign Het
Fam83e A T 7: 45,723,948 D246V probably damaging Het
Galnt2 T C 8: 124,338,584 probably benign Het
Hdc A G 2: 126,594,951 probably benign Het
Herc1 A C 9: 66,399,772 Q958P probably benign Het
Iqcg T A 16: 33,049,843 probably benign Het
Iqub A T 6: 24,450,830 F590Y probably damaging Het
Kbtbd11 G A 8: 15,027,499 A33T probably benign Het
Kcnip4 A G 5: 48,509,712 L37P probably damaging Het
Klk6 A G 7: 43,828,539 N112D probably damaging Het
Kmt2c G A 5: 25,354,747 T1011I probably damaging Het
Knl1 A T 2: 119,068,388 K190M probably damaging Het
Lama3 T A 18: 12,465,478 S981T possibly damaging Het
Lrrc18 T C 14: 33,008,651 L49P probably damaging Het
Lrrc31 T C 3: 30,687,525 E245G probably damaging Het
Macf1 T C 4: 123,444,944 I2456M probably benign Het
Mcm6 T A 1: 128,333,555 T771S probably benign Het
Met A C 6: 17,534,198 Y680S possibly damaging Het
Mixl1 T A 1: 180,696,646 T123S probably damaging Het
Myh8 A T 11: 67,292,905 I787F probably benign Het
Myocd A G 11: 65,196,225 F292S probably damaging Het
Neb T C 2: 52,313,890 probably null Het
Nfe2l1 A G 11: 96,827,368 S114P probably damaging Het
Nrxn2 T C 19: 6,491,521 S986P probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1453 T G 19: 13,027,931 T133P probably damaging Het
Olfr25 A T 9: 38,330,171 T195S probably benign Het
Olfr745 T C 14: 50,643,004 V241A possibly damaging Het
Olfr767 A G 10: 129,079,771 F64S probably damaging Het
Olfr920 G A 9: 38,756,129 G147D probably damaging Het
Oprl1 T C 2: 181,718,734 probably null Het
Panx2 T A 15: 89,068,407 I359N probably damaging Het
Pik3c2b T A 1: 133,077,396 V545E probably damaging Het
Piwil4 T C 9: 14,727,452 N259S probably benign Het
Plcxd2 A T 16: 45,980,556 F102I probably damaging Het
Pld5 A T 1: 176,089,956 M75K possibly damaging Het
Pmp22 T A 11: 63,151,103 probably benign Het
Polr2a A G 11: 69,741,019 S1074P possibly damaging Het
Pop1 T A 15: 34,526,206 V649E possibly damaging Het
Prc1 A G 7: 80,313,102 N548S probably damaging Het
Prss51 T C 14: 64,097,139 L202P probably damaging Het
Rhpn1 T C 15: 75,713,579 S576P possibly damaging Het
Rictor A G 15: 6,708,642 D20G probably benign Het
Rpl13a-ps1 A T 19: 50,030,206 L177* probably null Het
Rpl23a-ps1 T G 1: 45,981,927 noncoding transcript Het
Saa2 A G 7: 46,753,478 D51G probably damaging Het
Sec31a A T 5: 100,404,118 probably benign Het
Secisbp2 G A 13: 51,683,325 E841K possibly damaging Het
Serinc1 A G 10: 57,517,210 Y437H probably damaging Het
Slc39a12 A T 2: 14,435,681 H481L probably benign Het
Suz12 T A 11: 80,030,033 N586K probably damaging Het
Synm T C 7: 67,736,882 Y344C possibly damaging Het
Tas2r104 A G 6: 131,685,341 V135A probably benign Het
Tdrd9 T C 12: 112,068,239 S1371P probably benign Het
Tg T A 15: 66,828,533 D893E probably benign Het
Thoc5 C A 11: 4,918,217 D423E possibly damaging Het
Trim11 G A 11: 58,990,535 R418H probably damaging Het
Trim52 T G 14: 106,106,965 V19G probably damaging Het
Tuba4a C A 1: 75,215,858 V371L probably damaging Het
Ugt8a A G 3: 125,914,957 V168A probably benign Het
Ulk1 C T 5: 110,791,085 G496R probably damaging Het
Usp40 A G 1: 87,946,598 *1236Q probably null Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r24 A G 6: 123,780,391 probably null Het
Vmn2r53 A G 7: 12,582,411 Y494H probably damaging Het
Vmn2r65 T A 7: 84,946,234 D414V probably benign Het
Wdr26 A T 1: 181,182,879 L519* probably null Het
Wnk1 A G 6: 119,963,151 V173A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp318 T C 17: 46,396,708 S231P probably damaging Het
Zfp398 T C 6: 47,865,848 V146A probably benign Het
Zfp410 T C 12: 84,331,712 M270T probably damaging Het
Zfp445 A T 9: 122,853,513 H454Q possibly damaging Het
Other mutations in Jak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Jak2 APN 19 29301647 missense probably damaging 1.00
IGL00951:Jak2 APN 19 29299583 missense probably damaging 1.00
IGL01300:Jak2 APN 19 29309683 missense probably damaging 1.00
IGL01800:Jak2 APN 19 29286293 splice site probably benign
IGL02035:Jak2 APN 19 29286408 missense probably benign 0.24
IGL02212:Jak2 APN 19 29287982 missense probably benign 0.01
IGL02447:Jak2 APN 19 29299614 missense probably damaging 1.00
R0001:Jak2 UTSW 19 29282387 missense probably benign 0.01
R0158:Jak2 UTSW 19 29311757 missense probably benign
R0217:Jak2 UTSW 19 29296650 critical splice donor site probably null
R0308:Jak2 UTSW 19 29311757 missense probably benign 0.15
R0344:Jak2 UTSW 19 29283629 missense probably damaging 1.00
R0398:Jak2 UTSW 19 29282388 missense possibly damaging 0.95
R0408:Jak2 UTSW 19 29286317 missense probably benign 0.38
R0853:Jak2 UTSW 19 29284926 nonsense probably null
R1180:Jak2 UTSW 19 29282499 missense probably damaging 1.00
R1794:Jak2 UTSW 19 29299557 missense probably benign 0.00
R2247:Jak2 UTSW 19 29283636 missense probably benign 0.01
R3908:Jak2 UTSW 19 29291273 missense probably damaging 1.00
R4705:Jak2 UTSW 19 29294915 missense possibly damaging 0.82
R4744:Jak2 UTSW 19 29262256 missense probably benign 0.02
R4814:Jak2 UTSW 19 29301977 missense probably damaging 1.00
R4903:Jak2 UTSW 19 29275036 missense probably benign 0.03
R5602:Jak2 UTSW 19 29298339 missense probably benign 0.01
R5713:Jak2 UTSW 19 29271393 missense probably damaging 0.96
R5740:Jak2 UTSW 19 29262424 missense possibly damaging 0.81
R5758:Jak2 UTSW 19 29309643 missense probably damaging 1.00
R5966:Jak2 UTSW 19 29283554 missense possibly damaging 0.94
R6285:Jak2 UTSW 19 29295659 missense probably benign 0.35
R6439:Jak2 UTSW 19 29309622 splice site probably null
R6624:Jak2 UTSW 19 29282589 missense probably damaging 0.99
R6649:Jak2 UTSW 19 29288710 missense probably benign 0.00
R6653:Jak2 UTSW 19 29288710 missense probably benign 0.00
R7084:Jak2 UTSW 19 29286398 missense possibly damaging 0.78
R7180:Jak2 UTSW 19 29282411 missense probably benign 0.01
R7261:Jak2 UTSW 19 29310985 missense possibly damaging 0.82
R7488:Jak2 UTSW 19 29298383 missense probably damaging 0.99
R7537:Jak2 UTSW 19 29298637 missense probably benign 0.00
R7757:Jak2 UTSW 19 29283546 missense probably benign
R7777:Jak2 UTSW 19 29276868 missense probably benign 0.32
R8050:Jak2 UTSW 19 29298332 missense probably damaging 0.98
R8345:Jak2 UTSW 19 29284870 missense probably damaging 1.00
R8524:Jak2 UTSW 19 29295705 missense probably damaging 0.99
X0058:Jak2 UTSW 19 29295711 missense possibly damaging 0.91
Z1176:Jak2 UTSW 19 29271398 missense possibly damaging 0.58
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcctgtttgtctactgagcc -3'
Posted On2013-05-23