Incidental Mutation 'R5234:Sgsm3'
ID398247
Institutional Source Beutler Lab
Gene Symbol Sgsm3
Ensembl Gene ENSMUSG00000042303
Gene Namesmall G protein signaling modulator 3
SynonymsCIP85, Rutbc3, 1810012I01Rik
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80977765-81012290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81007944 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 238 (S238C)
Ref Sequence ENSEMBL: ENSMUSP00000122543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000137004] [ENSMUST00000137255] [ENSMUST00000139517] [ENSMUST00000143147] [ENSMUST00000149582] [ENSMUST00000228971] [ENSMUST00000229727]
PDB Structure
Solution structure of the SH3 domain of mouse RUN and TBC1 domain containing 3 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000042506
AA Change: S248C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043311
Gene: ENSMUSG00000103565
AA Change: S248C

DomainStartEndE-ValueType
TBC 121 338 3.6e-62 SMART
low complexity region 391 401 N/A INTRINSIC
SH3 493 548 6.34e-19 SMART
RUN 664 726 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109579
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124845
AA Change: S165C
Predicted Effect probably benign
Transcript: ENSMUST00000131235
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132039
Predicted Effect probably benign
Transcript: ENSMUST00000134469
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134559
Predicted Effect probably benign
Transcript: ENSMUST00000137004
Predicted Effect probably benign
Transcript: ENSMUST00000137255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138550
Predicted Effect probably damaging
Transcript: ENSMUST00000139517
AA Change: S238C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303
AA Change: S238C

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149345
Predicted Effect probably benign
Transcript: ENSMUST00000149582
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154904
SMART Domains Protein: ENSMUSP00000118050
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
SH3 114 169 6.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156783
Predicted Effect probably benign
Transcript: ENSMUST00000228971
Predicted Effect probably benign
Transcript: ENSMUST00000229727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230118
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Sgsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Sgsm3 APN 15 81010852 unclassified probably benign
IGL03370:Sgsm3 APN 15 81011654 critical splice acceptor site probably null
R0109:Sgsm3 UTSW 15 81009466 missense probably damaging 0.99
R0267:Sgsm3 UTSW 15 81006602 missense probably damaging 0.96
R0382:Sgsm3 UTSW 15 81008314 nonsense probably null
R0441:Sgsm3 UTSW 15 81009770 missense possibly damaging 0.87
R0631:Sgsm3 UTSW 15 81011736 makesense probably null
R0905:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R1364:Sgsm3 UTSW 15 81007942 missense probably damaging 0.98
R1515:Sgsm3 UTSW 15 81010256 missense probably benign 0.08
R2226:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2227:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2414:Sgsm3 UTSW 15 81006745 missense probably benign 0.10
R2508:Sgsm3 UTSW 15 81003872 critical splice donor site probably null
R4240:Sgsm3 UTSW 15 81011782 unclassified probably benign
R4302:Sgsm3 UTSW 15 81010301 unclassified probably benign
R4899:Sgsm3 UTSW 15 81006779 missense probably benign 0.13
R5288:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5385:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5386:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5682:Sgsm3 UTSW 15 81011460 critical splice acceptor site probably null
R6052:Sgsm3 UTSW 15 81009263 missense probably benign
R6349:Sgsm3 UTSW 15 81008346 missense probably benign 0.00
R6453:Sgsm3 UTSW 15 81011314 missense probably damaging 0.96
R6486:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R6591:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6642:Sgsm3 UTSW 15 81009700 missense probably damaging 0.99
R6691:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6897:Sgsm3 UTSW 15 81008894 missense probably benign 0.00
R7038:Sgsm3 UTSW 15 81008375 missense possibly damaging 0.86
R7390:Sgsm3 UTSW 15 81008820 missense possibly damaging 0.77
R7572:Sgsm3 UTSW 15 81007466 missense possibly damaging 0.78
R7730:Sgsm3 UTSW 15 81008726 missense probably damaging 1.00
R7851:Sgsm3 UTSW 15 81010753 missense probably damaging 1.00
R8186:Sgsm3 UTSW 15 81009442 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCAACCAGCCTGAAGAGGTG -3'
(R):5'- GCAACGTAAGCCACATGAGC -3'

Sequencing Primer
(F):5'- AAGAGGTGTGCCGAGTATCTATCC -3'
(R):5'- CTCGAAACCTTGGAGCTCAGAG -3'
Posted On2016-07-06