Incidental Mutation 'R5234:Ccnf'
ID 398251
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Name cyclin F
Synonyms CycF, Fbxo1
MMRRC Submission 042806-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5234 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 24441518-24470333 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 24453411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 343 (R343*)
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
AlphaFold P51944
Predicted Effect probably null
Transcript: ENSMUST00000115390
AA Change: R343*
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: R343*

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175529
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,302,823 (GRCm39) T2132M probably damaging Het
Abca8b A T 11: 109,867,420 (GRCm39) F213I possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Adamts6 A G 13: 104,630,130 (GRCm39) Y1091C probably damaging Het
Adamtsl4 T C 3: 95,588,230 (GRCm39) M586V probably benign Het
Anapc4 T C 5: 53,006,118 (GRCm39) S336P probably damaging Het
Atp1a4 A T 1: 172,054,737 (GRCm39) I964K possibly damaging Het
Bcan A T 3: 87,903,453 (GRCm39) D246E probably damaging Het
Col6a5 T C 9: 105,741,404 (GRCm39) H2505R probably damaging Het
Dlg5 T A 14: 24,242,930 (GRCm39) M72L probably damaging Het
Dnajc18 T C 18: 35,816,351 (GRCm39) T196A probably benign Het
Dnajc19 T A 3: 34,112,108 (GRCm39) I146F probably benign Het
Espnl A G 1: 91,272,515 (GRCm39) D581G probably benign Het
Fam167a T C 14: 63,689,787 (GRCm39) L28P probably damaging Het
Fra10ac1 T C 19: 38,204,294 (GRCm39) D94G probably damaging Het
Fut8 A G 12: 77,379,004 (GRCm39) H35R probably benign Het
Gad1-ps T A 10: 99,281,188 (GRCm39) noncoding transcript Het
Garin2 T A 12: 78,762,045 (GRCm39) Y236* probably null Het
Idh2 A T 7: 79,745,853 (GRCm39) V333E probably damaging Het
Inpp5f A G 7: 128,265,407 (GRCm39) I121V probably benign Het
Itga1 A T 13: 115,185,839 (GRCm39) Y54* probably null Het
Lax1 A G 1: 133,608,321 (GRCm39) V140A probably benign Het
Ncoa6 A G 2: 155,279,933 (GRCm39) F28L probably benign Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or1q1 T C 2: 36,887,107 (GRCm39) V95A probably benign Het
Polr2a T C 11: 69,627,666 (GRCm39) I1414V probably benign Het
Ppp1r14b A G 19: 6,954,227 (GRCm39) E115G possibly damaging Het
Prune2 A G 19: 17,096,032 (GRCm39) D512G probably damaging Het
Psmd11 A G 11: 80,319,566 (GRCm39) I19V probably benign Het
Pthlh C A 6: 147,158,592 (GRCm39) G123W probably damaging Het
Qars1 T A 9: 108,391,364 (GRCm39) L572Q probably damaging Het
Rubcn T C 16: 32,656,828 (GRCm39) I516V probably damaging Het
Sgsm3 A T 15: 80,892,145 (GRCm39) S238C probably damaging Het
Slc25a22 C A 7: 141,014,116 (GRCm39) probably benign Het
Slc4a1 G A 11: 102,252,209 (GRCm39) R5W probably benign Het
Tie1 G A 4: 118,339,959 (GRCm39) T356I probably benign Het
Tnn A T 1: 159,972,569 (GRCm39) H344Q possibly damaging Het
Tnrc6c G T 11: 117,651,555 (GRCm39) V1693F probably benign Het
Topaz1 C T 9: 122,619,258 (GRCm39) T1285M possibly damaging Het
Trank1 A T 9: 111,215,535 (GRCm39) S1822C probably damaging Het
Ttll11 A C 2: 35,830,745 (GRCm39) Y209D probably damaging Het
Unc45a C G 7: 79,978,547 (GRCm39) A634P probably benign Het
Vmn2r4 C T 3: 64,305,878 (GRCm39) V515I possibly damaging Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24,443,986 (GRCm39) missense probably damaging 1.00
IGL01942:Ccnf APN 17 24,461,294 (GRCm39) missense probably benign 0.03
IGL02251:Ccnf APN 17 24,445,513 (GRCm39) missense probably benign 0.00
IGL02945:Ccnf APN 17 24,443,890 (GRCm39) missense probably damaging 0.99
IGL02952:Ccnf APN 17 24,450,299 (GRCm39) missense possibly damaging 0.93
albuquerque UTSW 17 24,442,971 (GRCm39) nonsense probably null
R0326:Ccnf UTSW 17 24,450,784 (GRCm39) missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24,445,751 (GRCm39) missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24,442,971 (GRCm39) nonsense probably null
R1072:Ccnf UTSW 17 24,456,136 (GRCm39) missense probably damaging 0.97
R1693:Ccnf UTSW 17 24,445,514 (GRCm39) frame shift probably null
R2147:Ccnf UTSW 17 24,449,288 (GRCm39) critical splice donor site probably null
R3929:Ccnf UTSW 17 24,453,356 (GRCm39) missense probably damaging 1.00
R4081:Ccnf UTSW 17 24,442,872 (GRCm39) makesense probably null
R4260:Ccnf UTSW 17 24,445,741 (GRCm39) missense probably damaging 1.00
R4579:Ccnf UTSW 17 24,450,303 (GRCm39) nonsense probably null
R4651:Ccnf UTSW 17 24,450,760 (GRCm39) missense probably damaging 1.00
R4844:Ccnf UTSW 17 24,449,331 (GRCm39) nonsense probably null
R4876:Ccnf UTSW 17 24,449,311 (GRCm39) missense probably damaging 1.00
R5352:Ccnf UTSW 17 24,462,247 (GRCm39) splice site probably null
R5845:Ccnf UTSW 17 24,459,767 (GRCm39) missense possibly damaging 0.95
R6084:Ccnf UTSW 17 24,450,811 (GRCm39) missense probably damaging 1.00
R6219:Ccnf UTSW 17 24,445,678 (GRCm39) nonsense probably null
R7021:Ccnf UTSW 17 24,461,205 (GRCm39) missense probably damaging 1.00
R7176:Ccnf UTSW 17 24,468,376 (GRCm39) missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24,442,889 (GRCm39) missense probably benign 0.00
R7485:Ccnf UTSW 17 24,468,232 (GRCm39) missense probably damaging 0.97
R7763:Ccnf UTSW 17 24,443,986 (GRCm39) missense probably damaging 1.00
R8016:Ccnf UTSW 17 24,450,784 (GRCm39) missense possibly damaging 0.84
R8034:Ccnf UTSW 17 24,450,805 (GRCm39) missense probably damaging 1.00
R8069:Ccnf UTSW 17 24,443,989 (GRCm39) missense probably damaging 1.00
R9021:Ccnf UTSW 17 24,445,679 (GRCm39) nonsense probably null
R9623:Ccnf UTSW 17 24,468,367 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGTTGAGCCAGGTAAGG -3'
(R):5'- CAAAATGATGAGGCCACTTGC -3'

Sequencing Primer
(F):5'- CCAGGTAAGGCACTTAAGAG -3'
(R):5'- CTTGCTCAAGCTGAACAGACTTGG -3'
Posted On 2016-07-06