Incidental Mutation 'R5234:Fra10ac1'
ID398257
Institutional Source Beutler Lab
Gene Symbol Fra10ac1
Ensembl Gene ENSMUSG00000054237
Gene NameFRA10AC1 homolog (human)
Synonyms5730455O13Rik
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38188481-38224138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38215846 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 94 (D94G)
Ref Sequence ENSEMBL: ENSMUSP00000070534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067167]
Predicted Effect probably damaging
Transcript: ENSMUST00000067167
AA Change: D94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070534
Gene: ENSMUSG00000054237
AA Change: D94G

DomainStartEndE-ValueType
Pfam:Fra10Ac1 104 220 7e-56 PFAM
low complexity region 228 237 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 278 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear phosphoprotein of unknown function. This gene contains a tandem CGG repeat region within a CpG island that normally consists of 8-14 repeats but can expand to over 200 repeats. The repeat region is within the 5' UTR of some transcript variants, but is intronic to another variant. The expanded repeat allele is a fragile site and becomes hypermethylated, causing a reduction in gene expression. A disease phenotype has not been associated with expanded alleles. This gene is found within the rare FRA10A folate-sensitive fragile site. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Fra10ac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Fra10ac1 APN 19 38201564 missense probably damaging 0.99
IGL01784:Fra10ac1 APN 19 38219677 missense probably benign 0.32
IGL03396:Fra10ac1 APN 19 38201546 critical splice donor site probably null
R4349:Fra10ac1 UTSW 19 38199605 missense probably benign 0.00
R5090:Fra10ac1 UTSW 19 38214425 missense probably damaging 1.00
R5259:Fra10ac1 UTSW 19 38199662 missense probably benign 0.00
R5445:Fra10ac1 UTSW 19 38219462 missense possibly damaging 0.82
R5768:Fra10ac1 UTSW 19 38207286 missense probably benign 0.02
R6756:Fra10ac1 UTSW 19 38215865 missense probably damaging 1.00
R6831:Fra10ac1 UTSW 19 38207289 missense probably benign 0.38
R7011:Fra10ac1 UTSW 19 38188794 missense probably benign 0.11
R7054:Fra10ac1 UTSW 19 38224119 start gained probably benign
R7530:Fra10ac1 UTSW 19 38215905 nonsense probably null
R7561:Fra10ac1 UTSW 19 38221876 missense probably damaging 1.00
R7715:Fra10ac1 UTSW 19 38189838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAAAAGCAATCCTGGAC -3'
(R):5'- CAGAAAGTGAAAGTCTGCTGTG -3'

Sequencing Primer
(F):5'- CCTGGACACTATAGTCTAAGTGTGTC -3'
(R):5'- GTGTAGTTGTCGTACATGATTTACAC -3'
Posted On2016-07-06