Incidental Mutation 'R5235:Aox1'
ID398261
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58057555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 270 (V270L)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001027
AA Change: V270L

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: V270L

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160168
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8179:Aox1 UTSW 1 58097958 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTCTCTCAAATCCCTGTTG -3'
(R):5'- AGTTTCAGGACGAGAGCCAG -3'

Sequencing Primer
(F):5'- CACCAAAGACCAGAGTGT -3'
(R):5'- AGGATACCTGTACCCTGATGCTG -3'
Posted On2016-07-06