Incidental Mutation 'R5235:Sec16b'
ID398264
Institutional Source Beutler Lab
Gene Symbol Sec16b
Ensembl Gene ENSMUSG00000026589
Gene NameSEC16 homolog B (S. cerevisiae)
SynonymsRgpr, Lztr2, Rgpr-p117
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location157506728-157568425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 157534764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 251 (I251F)
Ref Sequence ENSEMBL: ENSMUSP00000107329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027881] [ENSMUST00000086130] [ENSMUST00000111700] [ENSMUST00000146873]
Predicted Effect probably benign
Transcript: ENSMUST00000027881
AA Change: I251F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027881
Gene: ENSMUSG00000026589
AA Change: I251F

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086130
AA Change: I251F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000083300
Gene: ENSMUSG00000026589
AA Change: I251F

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 271 370 4.8e-8 PFAM
Pfam:Sec16_C 437 677 2.2e-45 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111700
AA Change: I251F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107329
Gene: ENSMUSG00000026589
AA Change: I251F

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146873
AA Change: I62F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119359
Gene: ENSMUSG00000026589
AA Change: I62F

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
Pfam:Sec16 81 182 9.4e-20 PFAM
Pfam:Sec16_C 247 492 4.8e-39 PFAM
low complexity region 606 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155665
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEC16B is a mammalian homolog of S. cerevisiae Sec16 that is required for organization of transitional endoplasmic reticulum (ER) sites and protein export (Bhattacharyya and Glick, 2007 [PubMed 17192411]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Sec16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Sec16b APN 1 157538330 missense probably damaging 1.00
IGL00645:Sec16b APN 1 157566719 missense probably damaging 1.00
IGL00763:Sec16b APN 1 157529257 missense probably benign 0.00
IGL00822:Sec16b APN 1 157564555 missense probably benign 0.05
IGL02225:Sec16b APN 1 157532044 unclassified probably benign
IGL02746:Sec16b APN 1 157546289 splice site probably benign
IGL03031:Sec16b APN 1 157560799 missense probably benign
IGL03117:Sec16b APN 1 157535400 missense probably damaging 1.00
IGL03193:Sec16b APN 1 157535393 missense probably benign 0.01
R0206:Sec16b UTSW 1 157552935 nonsense probably null
R0208:Sec16b UTSW 1 157552935 nonsense probably null
R0349:Sec16b UTSW 1 157532176 splice site probably null
R0433:Sec16b UTSW 1 157534709 nonsense probably null
R0537:Sec16b UTSW 1 157537546 missense possibly damaging 0.91
R0593:Sec16b UTSW 1 157532148 missense probably benign 0.03
R0629:Sec16b UTSW 1 157564863 unclassified probably benign
R1028:Sec16b UTSW 1 157560917 missense probably benign 0.03
R1119:Sec16b UTSW 1 157564834 missense possibly damaging 0.93
R1835:Sec16b UTSW 1 157531312 missense probably benign 0.00
R1894:Sec16b UTSW 1 157552975 missense possibly damaging 0.90
R2307:Sec16b UTSW 1 157535492 missense probably damaging 1.00
R3438:Sec16b UTSW 1 157556758 splice site probably benign
R4788:Sec16b UTSW 1 157561524 missense possibly damaging 0.77
R5109:Sec16b UTSW 1 157564791 nonsense probably null
R5942:Sec16b UTSW 1 157531350 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6081:Sec16b UTSW 1 157560754 missense probably benign
R7026:Sec16b UTSW 1 157534711 missense possibly damaging 0.80
R7192:Sec16b UTSW 1 157529443 missense probably benign 0.00
R7270:Sec16b UTSW 1 157564462 missense probably damaging 1.00
R7270:Sec16b UTSW 1 157564463 missense probably damaging 1.00
R7404:Sec16b UTSW 1 157531357 missense probably damaging 1.00
R7494:Sec16b UTSW 1 157560799 missense probably benign
R7570:Sec16b UTSW 1 157531395 splice site probably null
R7747:Sec16b UTSW 1 157565472 missense possibly damaging 0.69
R7751:Sec16b UTSW 1 157558060 missense probably damaging 1.00
R7797:Sec16b UTSW 1 157561675 missense unknown
R7913:Sec16b UTSW 1 157529329 missense probably benign 0.00
R7943:Sec16b UTSW 1 157554757 missense probably benign
R8176:Sec16b UTSW 1 157535411 missense probably damaging 1.00
Z1088:Sec16b UTSW 1 157558024 splice site probably null
Z1176:Sec16b UTSW 1 157551069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCTCTCTGGAACTCCTTC -3'
(R):5'- GCAACCTATGATGCACATTCC -3'

Sequencing Primer
(F):5'- TCTGGAACTCCTTCCTACATAAC -3'
(R):5'- TTCCATTACTGAAGACAAGGCAG -3'
Posted On2016-07-06