Incidental Mutation 'R5235:Olfr1187-ps1'
ID398269
Institutional Source Beutler Lab
Gene Symbol Olfr1187-ps1
Ensembl Gene ENSMUSG00000068810
Gene Nameolfactory receptor 1187, pseudogene 1
SynonymsGA_x6K02T2Q125-50027818-50027495
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88540124-88540447 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 88540425 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000088203
Gene: ENSMUSG00000068810
AA Change: S7L

DomainStartEndE-ValueType
SCOP:d1l9ha_ 19 99 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177576
SMART Domains Protein: ENSMUSP00000137535
Gene: ENSMUSG00000068810

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Olfr1187-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02974:Olfr1187-ps1 APN 2 88540235 synonymous silent
IGL03348:Olfr1187-ps1 APN 2 88540141 exon noncoding transcript
R0784:Olfr1187-ps1 UTSW 2 88540167 exon noncoding transcript
R3724:Olfr1187-ps1 UTSW 2 88540286 exon noncoding transcript
R3805:Olfr1187-ps1 UTSW 2 88540356 exon noncoding transcript
R3806:Olfr1187-ps1 UTSW 2 88540356 exon noncoding transcript
R5464:Olfr1187-ps1 UTSW 2 88540255 splice site probably null
R5888:Olfr1187-ps1 UTSW 2 88540244 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAACATGCCATCTACTAGGGAC -3'
(R):5'- CCTCAGCCCCTTTATTGTTCAAAAG -3'

Sequencing Primer
(F):5'- GTGAGGAAAATGTACATAGGTGATC -3'
(R):5'- TCCAACTTGCAAGTGCTGG -3'
Posted On2016-07-06