Incidental Mutation 'R5235:Tpm3'
ID398278
Institutional Source Beutler Lab
Gene Symbol Tpm3
Ensembl Gene ENSMUSG00000027940
Gene Nametropomyosin 3, gamma
SynonymsskalphaTM.2, Trop-5, Tpm5, hTMnm, Tm5NM, gamma-TM, Tpm-5, hTM30nm
MMRRC Submission 042807-MU
Accession Numbers

Ncbi RefSeq: NM_022314.3, NM_001253738.1, NM_001253740.1; MGI:1890149

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90072649-90100902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90086495 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 97 (E97G)
Ref Sequence ENSEMBL: ENSMUSP00000113578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029549] [ENSMUST00000118566] [ENSMUST00000119158] [ENSMUST00000119570] [ENSMUST00000121503] [ENSMUST00000127955] [ENSMUST00000149432]
Predicted Effect probably benign
Transcript: ENSMUST00000029549
AA Change: E61G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029549
Gene: ENSMUSG00000027940
AA Change: E61G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 3.9e-22 PFAM
Pfam:Tropomyosin 12 248 7.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062193
AA Change: E97G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000062920
Gene: ENSMUSG00000027940
AA Change: E97G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.4e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118566
AA Change: E61G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113056
Gene: ENSMUSG00000027940
AA Change: E61G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 2e-21 PFAM
Pfam:Tropomyosin 12 248 1.7e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119158
AA Change: E61G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113219
Gene: ENSMUSG00000027940
AA Change: E61G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 1.7e-22 PFAM
Pfam:Tropomyosin 12 247 3.9e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119570
AA Change: E98G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113978
Gene: ENSMUSG00000027940
AA Change: E98G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 8 154 4.2e-35 PFAM
Pfam:CLZ 10 75 1.2e-9 PFAM
Pfam:Tropomyosin 49 285 3.7e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121503
AA Change: E97G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113578
Gene: ENSMUSG00000027940
AA Change: E97G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.3e-36 PFAM
Pfam:Tropomyosin 48 284 4.7e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151798
Predicted Effect probably benign
Transcript: ENSMUST00000149432
SMART Domains Protein: ENSMUSP00000114229
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin 1 70 1.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 3040795
Lethality: E1-E3
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous inactivation of this gene results in early embryonic death, prior to blastocyst formation. Mice homozygous for a targeted allele lacking exon 9 exhibit dysmorphic T-tubules and contraction in skeletal muscles. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(5) Gene trapped(71)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Tpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Tpm3 APN 3 90087717 missense probably damaging 0.99
IGL00949:Tpm3 APN 3 90089858 missense probably damaging 1.00
IGL01955:Tpm3 APN 3 90088435 missense probably benign 0.00
IGL01970:Tpm3 APN 3 90089828 missense probably damaging 1.00
IGL02605:Tpm3 APN 3 90088446 missense probably benign 0.13
IGL03352:Tpm3 APN 3 90087745 critical splice donor site probably null
IGL03375:Tpm3 APN 3 90073772 missense possibly damaging 0.83
P0045:Tpm3 UTSW 3 90091093 critical splice donor site probably null
R0006:Tpm3 UTSW 3 90087661 splice site probably benign
R0006:Tpm3 UTSW 3 90087661 splice site probably benign
R0024:Tpm3 UTSW 3 90087449 splice site probably null
R0086:Tpm3 UTSW 3 90090092 unclassified probably benign
R1487:Tpm3 UTSW 3 90090082 splice site probably null
R6639:Tpm3 UTSW 3 90079802 missense probably damaging 0.99
R7089:Tpm3 UTSW 3 90072722 start gained probably benign
R7212:Tpm3 UTSW 3 90091054 missense probably benign
R7867:Tpm3 UTSW 3 90086468 missense probably damaging 1.00
X0020:Tpm3 UTSW 3 90087574 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTTAGCATTTAAAGCAAGACAGGC -3'
(R):5'- TCCAGGTCAGAGCCACTATC -3'

Sequencing Primer
(F):5'- GCATTTAAAGCAAGACAGGCTCTATC -3'
(R):5'- GGTCAGAGCCACTATCAGCTTTAC -3'
Posted On2016-07-06