Incidental Mutation 'R5203:Krt79'
ID398283
Institutional Source Beutler Lab
Gene Symbol Krt79
Ensembl Gene ENSMUSG00000061397
Gene Namekeratin 79
Synonyms
MMRRC Submission 042778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5203 (G1)
Quality Score220
Status Not validated
Chromosome15
Chromosomal Location101929332-101940324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101929740 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 527 (S527P)
Ref Sequence ENSEMBL: ENSMUSP00000023799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023799]
Predicted Effect unknown
Transcript: ENSMUST00000023799
AA Change: S527P
SMART Domains Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: S527P

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 98 6.6e-11 PFAM
Pfam:Keratin_2_head 73 135 1.2e-21 PFAM
Filament 138 452 7.12e-159 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230441
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T G 16: 4,835,598 S4A unknown Het
Adgrv1 A T 13: 81,510,905 N2053K possibly damaging Het
Akr1c13 C T 13: 4,197,897 R223* probably null Het
Arhgef11 A G 3: 87,735,357 Y1370C probably damaging Het
Arid1a T C 4: 133,682,003 E1731G unknown Het
Cyp2c54 A T 19: 40,072,474 V75E probably damaging Het
Fa2h A G 8: 111,349,364 M209T probably benign Het
Fam171a1 T C 2: 3,223,545 I311T probably damaging Het
Fat3 C A 9: 16,378,142 L28F possibly damaging Het
Fntb C A 12: 76,837,572 P22Q probably benign Het
Gmeb1 T C 4: 132,232,009 probably null Het
Gpr22 A G 12: 31,709,788 S112P probably damaging Het
Htr7 A G 19: 35,964,392 S464P probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lnpep A T 17: 17,537,063 D858E probably damaging Het
Ly9 C A 1: 171,599,779 V403F probably damaging Het
Mindy4 A G 6: 55,255,661 Q363R probably benign Het
Mtmr10 G A 7: 64,318,161 V273I probably benign Het
Mup2 T A 4: 60,139,728 E20V probably damaging Het
Myo16 A G 8: 10,360,995 N151S probably damaging Het
Nod2 A C 8: 88,664,451 D462A probably damaging Het
Nt5c2 A G 19: 46,889,808 Y497H probably damaging Het
Olfr102 A T 17: 37,314,201 L61Q probably damaging Het
Olfr1294 A C 2: 111,537,636 Y218D probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhac1 A T 18: 37,091,190 D352V probably damaging Het
Psap A G 10: 60,294,975 D195G probably damaging Het
Scyl1 G A 19: 5,771,367 probably benign Het
Sh3bgr A G 16: 96,224,520 probably benign Het
Slc2a12 G T 10: 22,645,314 probably null Het
Slc2a12 G C 10: 22,692,218 V515L probably benign Het
Ttc17 T C 2: 94,378,716 Y131C probably damaging Het
Ttc27 A G 17: 74,777,654 D419G probably damaging Het
Ubxn8 T C 8: 33,633,611 E100G probably damaging Het
Zpbp T C 11: 11,408,451 E272G probably damaging Het
Other mutations in Krt79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Krt79 APN 15 101940166 missense probably damaging 0.98
IGL00546:Krt79 APN 15 101929873 missense probably benign 0.00
IGL01595:Krt79 APN 15 101931771 missense probably damaging 0.98
IGL02193:Krt79 APN 15 101939905 missense possibly damaging 0.59
R0639:Krt79 UTSW 15 101931548 nonsense probably null
R0980:Krt79 UTSW 15 101938007 missense probably damaging 1.00
R1839:Krt79 UTSW 15 101937938 missense possibly damaging 0.81
R4624:Krt79 UTSW 15 101939806 missense possibly damaging 0.92
R4745:Krt79 UTSW 15 101930684 missense probably damaging 1.00
R5382:Krt79 UTSW 15 101931440 missense probably benign 0.09
R5568:Krt79 UTSW 15 101929785 missense probably damaging 0.99
R6902:Krt79 UTSW 15 101931879 missense probably benign 0.08
R6916:Krt79 UTSW 15 101936170 missense probably benign 0.01
R6998:Krt79 UTSW 15 101937872 missense probably benign
R7009:Krt79 UTSW 15 101931441 missense probably damaging 1.00
R7663:Krt79 UTSW 15 101931843 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTGGTGACCCTAACTTCC -3'
(R):5'- CTTTGTTTGCAGCGGTGACC -3'

Sequencing Primer
(F):5'- CCTCCCATTCCACTGCATAAC -3'
(R):5'- GTGACCGGCAACTCTACCTC -3'
Posted On2016-07-06