Incidental Mutation 'R5235:C3ar1'
ID398295
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Namecomplement component 3a receptor 1
SynonymsC3aR, anaphylatoxin C3a receptor
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122847138-122856161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122850922 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 112 (L112P)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042081]
Predicted Effect probably damaging
Transcript: ENSMUST00000042081
AA Change: L112P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: L112P

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0014:C3ar1 UTSW 6 122850851 missense probably damaging 1.00
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0257:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R4840:C3ar1 UTSW 6 122850764 missense probably benign
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5610:C3ar1 UTSW 6 122850578 missense probably benign 0.01
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6327:C3ar1 UTSW 6 122850146 missense probably damaging 1.00
R6440:C3ar1 UTSW 6 122850508 missense probably damaging 0.99
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
R8049:C3ar1 UTSW 6 122850100 missense probably damaging 0.97
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGATTGTCCATAATGAACAGATC -3'
(R):5'- ATTGGGACTGCTAGGCAATGG -3'

Sequencing Primer
(F):5'- TCACGGTATACAAATACGGGC -3'
(R):5'- ATGAAGACGACCGTGAACAC -3'
Posted On2016-07-06