Incidental Mutation 'R5235:Aga'
ID398306
Institutional Source Beutler Lab
Gene Symbol Aga
Ensembl Gene ENSMUSG00000031521
Gene Nameaspartylglucosaminidase
Synonyms
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location53511727-53523421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53514326 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 124 (H124R)
Ref Sequence ENSEMBL: ENSMUSP00000148133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033920] [ENSMUST00000209811] [ENSMUST00000211424]
Predicted Effect probably damaging
Transcript: ENSMUST00000033920
AA Change: H124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033920
Gene: ENSMUSG00000031521
AA Change: H124R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Asparaginase_2 32 333 2.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209811
Predicted Effect probably damaging
Transcript: ENSMUST00000211424
AA Change: H124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an amidase enzyme that participates in the breakdown of glycoproteins in the cell. The encoded protein undergoes proteolytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit accumulation of aspartylglucosamine along with lysosomal vacuolization, axonal swelling in the gracile nucleus and impaired neuromotor coordination. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die prematurely and share most of the clinical, biochemical and histopathological characteristics of human aspartylglycosaminuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Aga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Aga APN 8 53518921 missense probably benign
IGL02581:Aga APN 8 53521044 splice site probably benign
IGL02617:Aga APN 8 53520313 missense possibly damaging 0.66
IGL03008:Aga APN 8 53511826 missense probably benign
R2099:Aga UTSW 8 53521131 nonsense probably null
R3747:Aga UTSW 8 53517821 missense probably benign
R4018:Aga UTSW 8 53523191 missense probably benign 0.00
R4247:Aga UTSW 8 53511830 missense possibly damaging 0.72
R4399:Aga UTSW 8 53511826 missense probably benign
R4421:Aga UTSW 8 53511826 missense probably benign
R4475:Aga UTSW 8 53511836 missense probably damaging 0.98
R5640:Aga UTSW 8 53511884 missense probably damaging 1.00
R7748:Aga UTSW 8 53511805 start codon destroyed possibly damaging 0.79
X0027:Aga UTSW 8 53521156 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCTGCTCCGAGAAATGCG -3'
(R):5'- TTGCTCTCTACATCACAGTAAGC -3'

Sequencing Primer
(F):5'- CGTAAATCTTCCACGTCCT -3'
(R):5'- CACAGTAAGCTAGTTATTTCCTTCC -3'
Posted On2016-07-06