Incidental Mutation 'R0454:Adcy10'
ID 39831
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms sAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 038654-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.376) question?
Stock # R0454 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165485183-165576774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 165570728 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1465 (Y1465N)
Ref Sequence ENSEMBL: ENSMUSP00000107067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: Y1465N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: Y1465N

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: Y1465N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: Y1465N

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: Y1465N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: Y1465N

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158666
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 (GRCm38) E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 (GRCm38) E91G unknown Het
Acot1 A G 12: 84,017,339 (GRCm38) Q407R probably benign Het
Ahsa2 T A 11: 23,490,702 (GRCm38) I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 (GRCm38) N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 (GRCm38) E216A probably damaging Het
Axin1 T C 17: 26,173,663 (GRCm38) V306A probably benign Het
BC005561 T G 5: 104,518,211 (GRCm38) S200A probably benign Het
Cct3 T C 3: 88,302,866 (GRCm38) probably null Het
Cfap58 G A 19: 47,974,680 (GRCm38) probably null Het
Chd9 T C 8: 90,973,231 (GRCm38) S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 (GRCm38) probably null Het
Col26a1 T C 5: 136,754,193 (GRCm38) N286D probably benign Het
Cpt1b T A 15: 89,424,393 (GRCm38) I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 (GRCm38) I30N probably damaging Het
Ddc T G 11: 11,880,587 (GRCm38) D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 (GRCm38) probably null Het
Evc2 T A 5: 37,417,484 (GRCm38) C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 (GRCm38) E134G probably damaging Het
Fasl T C 1: 161,787,954 (GRCm38) E111G probably benign Het
Fbxw10 A G 11: 62,876,738 (GRCm38) N800S possibly damaging Het
Fras1 T C 5: 96,762,665 (GRCm38) S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 (GRCm38) F383L probably damaging Het
Gad1 T A 2: 70,579,201 (GRCm38) M212K probably damaging Het
Gm17455 T G 10: 60,402,973 (GRCm38) S6A probably benign Het
Grm5 T C 7: 88,130,789 (GRCm38) S1146P probably damaging Het
Gsn T C 2: 35,304,639 (GRCm38) L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 (GRCm38) T112A probably benign Het
Hcn3 T A 3: 89,152,894 (GRCm38) I148F probably damaging Het
Hdac10 T C 15: 89,125,758 (GRCm38) probably null Het
Hk3 C A 13: 55,008,705 (GRCm38) D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 (GRCm38) R272S possibly damaging Het
Il1rap A C 16: 26,698,875 (GRCm38) D275A probably damaging Het
Itgam A T 7: 128,107,980 (GRCm38) N660I probably benign Het
Itpr3 T C 17: 27,113,819 (GRCm38) M1853T probably benign Het
Lrmp A G 6: 145,167,984 (GRCm38) R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 (GRCm38) K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 (GRCm38) S815P probably benign Het
Mast4 A G 13: 102,751,560 (GRCm38) S1114P probably damaging Het
Myh8 C T 11: 67,303,765 (GRCm38) Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 (GRCm38) D148G probably damaging Het
Nos1 T A 5: 117,943,320 (GRCm38) S1196T probably benign Het
Nsmaf C T 4: 6,424,874 (GRCm38) probably null Het
Obscn T C 11: 58,999,623 (GRCm38) D7361G unknown Het
Olfr1350 C T 7: 6,570,360 (GRCm38) A123V probably damaging Het
Olfr600 C A 7: 103,346,878 (GRCm38) A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 (GRCm38) V183A probably damaging Het
Pank3 T G 11: 35,777,709 (GRCm38) M175R probably benign Het
Papolg A G 11: 23,879,868 (GRCm38) probably null Het
Pcdhb21 G A 18: 37,514,513 (GRCm38) D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 (GRCm38) F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 (GRCm38) A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 (GRCm38) T87A possibly damaging Het
Pld1 T C 3: 28,124,575 (GRCm38) S873P probably damaging Het
Pld5 T A 1: 176,274,729 (GRCm38) Y49F probably benign Het
Polq T C 16: 37,034,890 (GRCm38) V449A probably damaging Het
Prkca A G 11: 107,978,280 (GRCm38) V69A probably benign Het
Ptk6 A G 2: 181,202,282 (GRCm38) S75P possibly damaging Het
Ptprq G A 10: 107,582,530 (GRCm38) Q1662* probably null Het
Ptprt C A 2: 161,553,822 (GRCm38) A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 (GRCm38) W684R probably damaging Het
Ryr1 T A 7: 29,036,075 (GRCm38) M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 (GRCm38) L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 (GRCm38) Y188* probably null Het
Slc31a1 C T 4: 62,385,629 (GRCm38) probably benign Het
Slc5a11 C G 7: 123,265,235 (GRCm38) S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 (GRCm38) L387P probably benign Het
Slitrk6 A T 14: 110,749,932 (GRCm38) L781H probably damaging Het
Spam1 T A 6: 24,797,838 (GRCm38) L331Q probably damaging Het
Spata32 A G 11: 103,209,299 (GRCm38) W127R probably damaging Het
Spta1 T G 1: 174,213,942 (GRCm38) I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 (GRCm38) Y176C probably damaging Het
Stk10 A G 11: 32,596,724 (GRCm38) E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 (GRCm38) Y912F possibly damaging Het
Tchp G A 5: 114,720,182 (GRCm38) E459K probably benign Het
Terf2 C T 8: 107,096,210 (GRCm38) W100* probably null Het
Thrsp T C 7: 97,417,427 (GRCm38) N26S probably damaging Het
Tln1 C A 4: 43,553,504 (GRCm38) R297L probably benign Het
Tmeff2 C A 1: 50,928,075 (GRCm38) T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 (GRCm38) A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 (GRCm38) L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 (GRCm38) K107N probably damaging Het
Trpa1 A T 1: 14,885,748 (GRCm38) probably null Het
Trrap A G 5: 144,846,477 (GRCm38) K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 (GRCm38) V14I probably benign Het
Usp19 T C 9: 108,494,240 (GRCm38) probably null Het
Usp28 C A 9: 49,039,101 (GRCm38) D615E possibly damaging Het
Utp20 T C 10: 88,822,069 (GRCm38) D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 (GRCm38) K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 (GRCm38) M96V probably benign Het
Wdr90 T C 17: 25,860,049 (GRCm38) E273G probably damaging Het
Xpc C T 6: 91,491,226 (GRCm38) A860T probably benign Het
Zscan21 T C 5: 138,133,603 (GRCm38) I463T possibly damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,551,914 (GRCm38) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,572,614 (GRCm38) missense probably benign
IGL01099:Adcy10 APN 1 165,539,842 (GRCm38) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,546,587 (GRCm38) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,513,168 (GRCm38) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,521,843 (GRCm38) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,570,620 (GRCm38) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,572,543 (GRCm38) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,559,128 (GRCm38) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,538,380 (GRCm38) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,510,408 (GRCm38) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,570,744 (GRCm38) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,567,726 (GRCm38) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,543,233 (GRCm38) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,519,518 (GRCm38) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,538,475 (GRCm38) nonsense probably null
Bugged UTSW 1 165,564,237 (GRCm38) missense probably damaging 0.99
debye UTSW 1 165,551,361 (GRCm38) critical splice donor site probably null
malaysian UTSW 1 165,513,127 (GRCm38) missense probably benign 0.38
singaporean UTSW 1 165,518,312 (GRCm38) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,556,791 (GRCm38) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,539,834 (GRCm38) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,539,834 (GRCm38) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,572,591 (GRCm38) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,564,249 (GRCm38) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,552,022 (GRCm38) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,510,390 (GRCm38) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,519,519 (GRCm38) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,564,023 (GRCm38) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,565,315 (GRCm38) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,513,130 (GRCm38) missense probably benign
R0597:Adcy10 UTSW 1 165,525,062 (GRCm38) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,543,105 (GRCm38) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,563,947 (GRCm38) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,515,380 (GRCm38) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,518,403 (GRCm38) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,518,312 (GRCm38) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,525,033 (GRCm38) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,519,925 (GRCm38) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,503,243 (GRCm38) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,521,961 (GRCm38) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,570,808 (GRCm38) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,510,297 (GRCm38) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,525,022 (GRCm38) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,518,212 (GRCm38) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,518,260 (GRCm38) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,518,260 (GRCm38) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,510,297 (GRCm38) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,558,597 (GRCm38) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,575,727 (GRCm38) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,513,127 (GRCm38) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,551,361 (GRCm38) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,504,049 (GRCm38) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,506,644 (GRCm38) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,548,213 (GRCm38) missense probably benign
R4916:Adcy10 UTSW 1 165,518,246 (GRCm38) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,563,963 (GRCm38) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,556,862 (GRCm38) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,519,500 (GRCm38) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,519,895 (GRCm38) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,513,140 (GRCm38) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,515,306 (GRCm38) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,539,817 (GRCm38) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,541,649 (GRCm38) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,575,728 (GRCm38) nonsense probably null
R6455:Adcy10 UTSW 1 165,518,374 (GRCm38) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,575,658 (GRCm38) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,506,635 (GRCm38) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,564,285 (GRCm38) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,556,916 (GRCm38) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,518,246 (GRCm38) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,539,874 (GRCm38) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,538,522 (GRCm38) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,504,047 (GRCm38) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,510,370 (GRCm38) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,543,470 (GRCm38) splice site probably null
R7228:Adcy10 UTSW 1 165,510,272 (GRCm38) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,576,608 (GRCm38) missense unknown
R7561:Adcy10 UTSW 1 165,559,172 (GRCm38) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,564,237 (GRCm38) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,570,771 (GRCm38) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,515,369 (GRCm38) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,513,168 (GRCm38) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,552,024 (GRCm38) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,546,549 (GRCm38) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,503,288 (GRCm38) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,510,337 (GRCm38) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,551,298 (GRCm38) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,518,345 (GRCm38) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,575,649 (GRCm38) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,543,110 (GRCm38) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,513,112 (GRCm38) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,552,109 (GRCm38) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,510,276 (GRCm38) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCATACACAGAGATCTGTCGGGAAG -3'
(R):5'- AGACTCATGGACACATGCAGGAAAC -3'

Sequencing Primer
(F):5'- ATCTGTCGGGAAGCCAGC -3'
(R):5'- gcagcaagcaccgttacc -3'
Posted On 2013-05-23