Incidental Mutation 'R5235:Dag1'
ID398313
Institutional Source Beutler Lab
Gene Symbol Dag1
Ensembl Gene ENSMUSG00000039952
Gene Namedystroglycan 1
SynonymsD9Wsu13e, dystrophin associated glycoprotein 1, beta-dystroglycan, DG, alpha-dystroglycan
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108204634-108263958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108207698 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 748 (Y748C)
Ref Sequence ENSEMBL: ENSMUSP00000142109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080435] [ENSMUST00000166905] [ENSMUST00000171412] [ENSMUST00000191899]
Predicted Effect probably damaging
Transcript: ENSMUST00000080435
AA Change: Y748C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079294
Gene: ENSMUSG00000039952
AA Change: Y748C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166905
AA Change: Y748C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128531
Gene: ENSMUSG00000039952
AA Change: Y748C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.5e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171412
AA Change: Y748C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130626
Gene: ENSMUSG00000039952
AA Change: Y748C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191899
AA Change: Y748C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142109
Gene: ENSMUSG00000039952
AA Change: Y748C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteolytic processing to generate alpha and beta subunits. A complete lack of the encoded protein in mice results in embryonic lethality due to the disorganization of Reichert's membrane. Chimeric mice deficient in the encoded protein overcome embryonic lethality but develop a progressive muscular dystrophy. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mutant embryos show gross abnormalities, particularly defective Reichert's membrane by 6.5 days, indicating a possible role for this gene product in basement membrane organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Dag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Dag1 APN 9 108209288 missense probably damaging 0.99
IGL00780:Dag1 APN 9 108209619 missense probably damaging 1.00
IGL01488:Dag1 APN 9 108208303 missense probably benign 0.33
IGL01843:Dag1 APN 9 108208082 missense possibly damaging 0.92
IGL02140:Dag1 APN 9 108218192 missense probably damaging 1.00
IGL02980:Dag1 UTSW 9 108218038 missense probably benign 0.02
R0037:Dag1 UTSW 9 108207353 missense probably damaging 0.99
R0172:Dag1 UTSW 9 108208832 missense possibly damaging 0.58
R0513:Dag1 UTSW 9 108208485 missense possibly damaging 0.93
R1715:Dag1 UTSW 9 108208715 missense possibly damaging 0.92
R2328:Dag1 UTSW 9 108209252 missense probably damaging 0.99
R2337:Dag1 UTSW 9 108207397 nonsense probably null
R3765:Dag1 UTSW 9 108208199 missense probably damaging 1.00
R4478:Dag1 UTSW 9 108208730 missense probably damaging 1.00
R5000:Dag1 UTSW 9 108208017 missense probably benign
R5127:Dag1 UTSW 9 108207572 missense possibly damaging 0.86
R5265:Dag1 UTSW 9 108207699 missense possibly damaging 0.93
R5315:Dag1 UTSW 9 108209117 missense probably damaging 1.00
R5620:Dag1 UTSW 9 108209015 missense probably damaging 1.00
R5696:Dag1 UTSW 9 108209447 missense probably benign 0.09
R5731:Dag1 UTSW 9 108218111 missense probably benign
R6382:Dag1 UTSW 9 108208137 missense possibly damaging 0.83
R6652:Dag1 UTSW 9 108209090 missense probably damaging 1.00
R6757:Dag1 UTSW 9 108218017 missense probably damaging 0.99
R6870:Dag1 UTSW 9 108209258 missense probably damaging 1.00
R7316:Dag1 UTSW 9 108209502 missense probably benign 0.00
R7343:Dag1 UTSW 9 108209093 missense possibly damaging 0.88
R7543:Dag1 UTSW 9 108218081 missense probably benign
R7733:Dag1 UTSW 9 108208848 missense probably benign 0.33
Z1088:Dag1 UTSW 9 108208668 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAGAGTCATCCAGCTCATCCG -3'
(R):5'- AGCAGATCATAGGGCTGAGC -3'

Sequencing Primer
(F):5'- TCATCCGCAAAGATGATAGGC -3'
(R):5'- AAATGGGAAGCCTCGTCCTG -3'
Posted On2016-07-06