Incidental Mutation 'R5204:Tor3a'
ID398316
Institutional Source Beutler Lab
Gene Symbol Tor3a
Ensembl Gene ENSMUSG00000060519
Gene Nametorsin family 3, member A
SynonymsAdir
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156653617-156674356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156655700 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 384 (L384P)
Ref Sequence ENSEMBL: ENSMUSP00000140079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079625] [ENSMUST00000122242] [ENSMUST00000150557] [ENSMUST00000156861] [ENSMUST00000188964]
Predicted Effect probably damaging
Transcript: ENSMUST00000079625
AA Change: L384P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078572
Gene: ENSMUSG00000060519
AA Change: L384P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122242
AA Change: L384P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113984
Gene: ENSMUSG00000060519
AA Change: L384P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150557
SMART Domains Protein: ENSMUSP00000137828
Gene: ENSMUSG00000060519

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 206 2.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154353
Predicted Effect probably benign
Transcript: ENSMUST00000156861
SMART Domains Protein: ENSMUSP00000140808
Gene: ENSMUSG00000060519

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188964
AA Change: L384P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140079
Gene: ENSMUSG00000060519
AA Change: L384P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Abt1 G A 13: 23,422,668 R88C probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Ccdc57 A G 11: 120,886,062 V504A possibly damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clec4b1 T A 6: 123,071,535 *210R probably null Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klhl5 G T 5: 65,131,438 L14F possibly damaging Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Olfr609 C T 7: 103,492,540 V113M probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Rufy1 C T 11: 50,406,434 R397Q probably damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tmem30c T C 16: 57,270,022 N274S possibly damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Tor3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Tor3a APN 1 156674206 missense probably benign 0.33
IGL03268:Tor3a APN 1 156669450 missense probably damaging 1.00
R2943:Tor3a UTSW 1 156674095 missense probably benign 0.38
R3858:Tor3a UTSW 1 156669554 missense probably damaging 1.00
R4996:Tor3a UTSW 1 156655772 missense probably damaging 1.00
R5352:Tor3a UTSW 1 156674193 missense probably damaging 1.00
R5476:Tor3a UTSW 1 156673567 missense possibly damaging 0.94
R5653:Tor3a UTSW 1 156656510 missense probably damaging 1.00
R5931:Tor3a UTSW 1 156656487 missense probably benign 0.03
R6170:Tor3a UTSW 1 156656573 missense possibly damaging 0.89
R7674:Tor3a UTSW 1 156655908 missense possibly damaging 0.77
R8833:Tor3a UTSW 1 156655803 missense probably benign
Z1177:Tor3a UTSW 1 156674230 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTTGGTACTTGGACCTTCCG -3'
(R):5'- TGGAGTACTGCCATGTGAGG -3'

Sequencing Primer
(F):5'- TGACCCTCAGTCTAGATTGTCTAG -3'
(R):5'- CCATGTGAGGCTGTGCGTC -3'
Posted On2016-07-06