Incidental Mutation 'R5235:Stat2'
ID398317
Institutional Source Beutler Lab
Gene Symbol Stat2
Ensembl Gene ENSMUSG00000040033
Gene Namesignal transducer and activator of transcription 2
Synonyms1600010G07Rik
MMRRC Submission 042807-MU
Accession Numbers

Genbank: NM_019963.1; Ensembl: ENSMUST00000085708

Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128270559-128292849 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 128291032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085708] [ENSMUST00000105238]
Predicted Effect probably null
Transcript: ENSMUST00000085708
SMART Domains Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 138 314 5e-52 PFAM
Pfam:STAT_bind 316 564 1.2e-96 PFAM
SH2 576 652 4.71e-6 SMART
internal_repeat_1 750 778 6.35e-10 PROSPERO
internal_repeat_1 822 850 6.35e-10 PROSPERO
Pfam:STAT2_C 853 907 1.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105238
SMART Domains Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 141 314 2.6e-49 PFAM
Pfam:STAT_bind 316 564 1.5e-67 PFAM
SH2 577 653 4.71e-6 SMART
internal_repeat_1 751 779 6.69e-10 PROSPERO
internal_repeat_1 823 851 6.69e-10 PROSPERO
Pfam:STAT2_C 854 908 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220277
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Stat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Stat2 APN 10 128281176 missense probably benign 0.42
IGL02528:Stat2 APN 10 128290665 missense probably benign 0.07
IGL02859:Stat2 APN 10 128276611 missense probably damaging 1.00
IGL03119:Stat2 APN 10 128283517 missense probably benign 0.15
numb UTSW 10 128281065 splice site probably null
1mM(1):Stat2 UTSW 10 128277723 missense probably benign 0.06
R0098:Stat2 UTSW 10 128283262 missense probably damaging 1.00
R0334:Stat2 UTSW 10 128277867 missense probably damaging 1.00
R0496:Stat2 UTSW 10 128276509 missense probably benign 0.04
R1478:Stat2 UTSW 10 128282100 critical splice acceptor site probably null
R2857:Stat2 UTSW 10 128276901 splice site probably null
R3698:Stat2 UTSW 10 128278793 missense probably benign 0.30
R3870:Stat2 UTSW 10 128277893 missense probably benign 0.17
R5231:Stat2 UTSW 10 128281242 critical splice donor site probably null
R5264:Stat2 UTSW 10 128281065 splice site probably null
R5855:Stat2 UTSW 10 128283494 missense probably damaging 1.00
R6752:Stat2 UTSW 10 128283753 missense probably damaging 1.00
R7459:Stat2 UTSW 10 128276565 missense possibly damaging 0.95
R7467:Stat2 UTSW 10 128277903 splice site probably null
R7599:Stat2 UTSW 10 128277197 missense possibly damaging 0.45
R7756:Stat2 UTSW 10 128290728 small deletion probably benign
R7814:Stat2 UTSW 10 128290728 small deletion probably benign
R7992:Stat2 UTSW 10 128284962 missense probably damaging 1.00
R8335:Stat2 UTSW 10 128276583 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACAAGTCCTGCTGGAGCTAG -3'
(R):5'- GTATGGAAGTCTCATCTCCACTG -3'

Sequencing Primer
(F):5'- TGGAGCTAGCCCCACAAGTC -3'
(R):5'- GGTTGCTTAATTCTAGAGGACACAG -3'
Posted On2016-07-06