Incidental Mutation 'R5235:Dek'
ID398320
Institutional Source Beutler Lab
Gene Symbol Dek
Ensembl Gene ENSMUSG00000021377
Gene NameDEK oncogene (DNA binding)
SynonymsD13H6S231E, 1810019E15Rik
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location47084775-47106201 bp(-) (GRCm38)
Type of Mutationsplice site (1883 bp from exon)
DNA Base Change (assembly) A to T at 47086479 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021807] [ENSMUST00000037025] [ENSMUST00000135278] [ENSMUST00000224150]
Predicted Effect probably null
Transcript: ENSMUST00000021807
AA Change: Y359*
SMART Domains Protein: ENSMUSP00000021807
Gene: ENSMUSG00000021377
AA Change: Y359*

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
low complexity region 190 210 N/A INTRINSIC
low complexity region 231 315 N/A INTRINSIC
Pfam:DEK_C 327 379 3.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128977
Predicted Effect probably benign
Transcript: ENSMUST00000135278
SMART Domains Protein: ENSMUSP00000121663
Gene: ENSMUSG00000021377

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138401
Predicted Effect probably null
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224150
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed development of DMBA- and TPA-induced papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Dek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Dek APN 13 47088135 missense probably benign 0.37
R1438:Dek UTSW 13 47088171 missense probably benign 0.23
R4118:Dek UTSW 13 47088600 missense probably benign 0.01
R5847:Dek UTSW 13 47101601 unclassified probably benign
R6285:Dek UTSW 13 47099380 missense probably damaging 1.00
R6736:Dek UTSW 13 47099390 missense probably damaging 1.00
R6903:Dek UTSW 13 47098187 missense possibly damaging 0.83
R7120:Dek UTSW 13 47100183 missense unknown
R7359:Dek UTSW 13 47105589 missense unknown
R7372:Dek UTSW 13 47105577 missense unknown
R7504:Dek UTSW 13 47088035 missense probably damaging 1.00
RF016:Dek UTSW 13 47098186 nonsense probably null
Z1177:Dek UTSW 13 47105626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCTACCATGTGTACTATGAACC -3'
(R):5'- AGCACTAAGAATGTCAGGTGAC -3'

Sequencing Primer
(F):5'- TCCTCATCCATATTAACTCTGAGATG -3'
(R):5'- AGAATGTCAGGTGACTTTATTGC -3'
Posted On2016-07-06