Incidental Mutation 'R5235:Snx29'
ID398326
Institutional Source Beutler Lab
Gene Symbol Snx29
Ensembl Gene ENSMUSG00000071669
Gene Namesorting nexin 29
Synonyms4933437K13Rik, LOC381035, LOC385605, Gm11170, Rundc2a
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score224
Status Not validated
Chromosome16
Chromosomal Location11322908-11755472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11413246 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 39 (C39F)
Ref Sequence ENSEMBL: ENSMUSP00000093993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096273] [ENSMUST00000122168] [ENSMUST00000180792]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096273
AA Change: C39F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669
AA Change: C39F

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122168
AA Change: C23F

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669
AA Change: C23F

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180792
AA Change: C381F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669
AA Change: C381F

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Snx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Snx29 APN 16 11403502 missense probably damaging 0.97
IGL02207:Snx29 APN 16 11738352 missense probably damaging 1.00
PIT1430001:Snx29 UTSW 16 11403624 missense probably benign 0.00
PIT4810001:Snx29 UTSW 16 11400981 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0276:Snx29 UTSW 16 11738373 missense probably benign 0.01
R0506:Snx29 UTSW 16 11395303 missense probably benign 0.15
R0621:Snx29 UTSW 16 11405787 splice site probably null
R0975:Snx29 UTSW 16 11347871 missense possibly damaging 0.66
R1225:Snx29 UTSW 16 11420686 intron probably benign
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1452:Snx29 UTSW 16 11631471 missense probably damaging 1.00
R1515:Snx29 UTSW 16 11399837 critical splice donor site probably null
R1874:Snx29 UTSW 16 11367681 missense probably benign 0.01
R1953:Snx29 UTSW 16 11399783 nonsense probably null
R1978:Snx29 UTSW 16 11367724 missense probably benign 0.23
R2054:Snx29 UTSW 16 11631492 missense probably damaging 1.00
R2105:Snx29 UTSW 16 11511034 missense possibly damaging 0.72
R2128:Snx29 UTSW 16 11400971 missense probably damaging 0.98
R2152:Snx29 UTSW 16 11400843 missense possibly damaging 0.95
R2912:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2913:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2914:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R4468:Snx29 UTSW 16 11420701 splice site probably null
R4469:Snx29 UTSW 16 11420701 splice site probably null
R4612:Snx29 UTSW 16 11447495 missense probably damaging 0.99
R4744:Snx29 UTSW 16 11349909 nonsense probably null
R4798:Snx29 UTSW 16 11420736 missense probably damaging 1.00
R5000:Snx29 UTSW 16 11403507 missense probably damaging 0.99
R5165:Snx29 UTSW 16 11420775 missense probably damaging 0.98
R5207:Snx29 UTSW 16 11738363 missense probably damaging 1.00
R5274:Snx29 UTSW 16 11738404 missense probably damaging 1.00
R5277:Snx29 UTSW 16 11399824 missense possibly damaging 0.82
R5462:Snx29 UTSW 16 11511012 missense possibly damaging 0.89
R5655:Snx29 UTSW 16 11755321 missense probably damaging 1.00
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6326:Snx29 UTSW 16 11403566 missense probably benign
R6576:Snx29 UTSW 16 11715056 critical splice donor site probably null
R7406:Snx29 UTSW 16 11755316 missense probably damaging 1.00
R7552:Snx29 UTSW 16 11420785 critical splice donor site probably null
R7555:Snx29 UTSW 16 11400942 missense probably benign 0.02
R7736:Snx29 UTSW 16 11367724 missense probably benign 0.23
R7962:Snx29 UTSW 16 11413357 critical splice donor site probably null
R8101:Snx29 UTSW 16 11571716 missense probably benign 0.16
R8415:Snx29 UTSW 16 11447427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCAGGCTCTCATAAACAAG -3'
(R):5'- CTTCTTAAATGAATGTCCACAAGCC -3'

Sequencing Primer
(F):5'- CTCATAAACAAGTACTTGAGGGGTCC -3'
(R):5'- AAGCCATCCTTGCCCTGAG -3'
Posted On2016-07-06