Incidental Mutation 'R5235:Liph'
ID398328
Institutional Source Beutler Lab
Gene Symbol Liph
Ensembl Gene ENSMUSG00000044626
Gene Namelipase, member H
SynonymsD16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location21953817-21995663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21984035 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 95 (L95V)
Ref Sequence ENSEMBL: ENSMUSP00000156378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]
Predicted Effect probably damaging
Transcript: ENSMUST00000060673
AA Change: L95V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626
AA Change: L95V

DomainStartEndE-ValueType
Pfam:Lipase 11 326 6.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074230
AA Change: L95V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626
AA Change: L95V

DomainStartEndE-ValueType
Pfam:Lipase 15 214 1.5e-45 PFAM
Pfam:Abhydrolase_6 73 296 2.3e-6 PFAM
Pfam:Lipase 209 296 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231682
AA Change: L95V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231766
AA Change: L95V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Liph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Liph APN 16 21968140 missense probably damaging 1.00
babyback UTSW 16 21983957 missense probably damaging 0.97
PIT4131001:Liph UTSW 16 21995369 start codon destroyed probably null 0.59
R0004:Liph UTSW 16 21984194 nonsense probably null
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0348:Liph UTSW 16 21967980 splice site probably null
R0689:Liph UTSW 16 21968068 missense probably damaging 1.00
R0715:Liph UTSW 16 21995350 missense probably benign 0.05
R1104:Liph UTSW 16 21984148 missense possibly damaging 0.82
R1779:Liph UTSW 16 21968050 missense probably benign 0.01
R2323:Liph UTSW 16 21984004 missense probably damaging 0.99
R3913:Liph UTSW 16 21962259 splice site probably benign
R4402:Liph UTSW 16 21976250 missense probably damaging 1.00
R4454:Liph UTSW 16 21984268 missense probably benign 0.11
R4672:Liph UTSW 16 21984056 missense probably benign 0.14
R4681:Liph UTSW 16 21984027 missense probably benign 0.02
R5111:Liph UTSW 16 21984070 missense probably damaging 1.00
R5135:Liph UTSW 16 21956165 nonsense probably null
R5642:Liph UTSW 16 21965995 missense possibly damaging 0.61
R5810:Liph UTSW 16 21968110 missense probably damaging 1.00
R6188:Liph UTSW 16 21984268 missense probably benign 0.11
R6557:Liph UTSW 16 21983920 missense possibly damaging 0.60
R6734:Liph UTSW 16 21983957 missense probably damaging 0.97
R7011:Liph UTSW 16 21984097 missense probably damaging 0.98
R7038:Liph UTSW 16 21976259 missense probably damaging 1.00
R7178:Liph UTSW 16 21976328 missense probably damaging 1.00
R7185:Liph UTSW 16 21995339 missense probably benign 0.00
R7198:Liph UTSW 16 21966022 missense probably damaging 1.00
R7775:Liph UTSW 16 21958914 missense probably damaging 1.00
R7832:Liph UTSW 16 21962236 missense probably benign 0.01
R7993:Liph UTSW 16 21958812 missense probably benign 0.03
R8264:Liph UTSW 16 21983971 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGTTTTAAGCTTCCAAACCAGC -3'
(R):5'- CCTTCACCAGACTGAGCTTC -3'

Sequencing Primer
(F):5'- GCCACCAAGGTCATCTCAG -3'
(R):5'- GGTTGGTACAGGACTCTCCG -3'
Posted On2016-07-06