Incidental Mutation 'R5235:Atg3'
ID398330
Institutional Source Beutler Lab
Gene Symbol Atg3
Ensembl Gene ENSMUSG00000022663
Gene Nameautophagy related 3
SynonymsPC3-96, 2610016C12Rik, Apg3l, APG3
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45158785-45188538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45159157 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 20 (T20A)
Ref Sequence ENSEMBL: ENSMUSP00000023343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023343] [ENSMUST00000023344] [ENSMUST00000114600] [ENSMUST00000180636] [ENSMUST00000181177] [ENSMUST00000181750]
Predicted Effect probably benign
Transcript: ENSMUST00000023343
AA Change: T20A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023343
Gene: ENSMUSG00000022663
AA Change: T20A

DomainStartEndE-ValueType
Pfam:Autophagy_N 8 153 1.4e-55 PFAM
Pfam:Autophagy_act_C 204 265 8.8e-23 PFAM
Pfam:Autophagy_C 286 310 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023344
SMART Domains Protein: ENSMUSP00000023344
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 28 387 1.3e-54 PFAM
low complexity region 424 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114600
SMART Domains Protein: ENSMUSP00000110247
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Nuc_sug_transp 107 155 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180636
SMART Domains Protein: ENSMUSP00000137821
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:UAA 30 196 5.2e-8 PFAM
Pfam:TPT 31 177 3.3e-7 PFAM
Pfam:EamA 73 179 1.2e-7 PFAM
Pfam:Nuc_sug_transp 91 222 7.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181177
SMART Domains Protein: ENSMUSP00000137789
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 30 94 1.1e-12 PFAM
low complexity region 139 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181437
Predicted Effect probably benign
Transcript: ENSMUST00000181750
SMART Domains Protein: ENSMUSP00000137937
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
transmembrane domain 15 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like-conjugating enzyme and is a component of ubiquitination-like systems involved in autophagy, the process of degradation, turnover and recycling of cytoplasmic constituents in eukaryotic cells. This protein is known to play a role in regulation of autophagy during cell death. A pseudogene of this gene is located on chromosome 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit decreased autophagy, decreased T cell proliferation, and increased T cell apoptosis. Mice homozygous for a knock-out allele exhibit decreased birth weight, neonatal lethality and abnormal autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Atg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Atg3 APN 16 45183811 critical splice donor site probably null
IGL01298:Atg3 APN 16 45171673 missense possibly damaging 0.78
IGL02285:Atg3 APN 16 45178317 splice site probably benign
IGL02626:Atg3 APN 16 45183685 missense probably benign 0.04
R1494:Atg3 UTSW 16 45171760 splice site probably benign
R3625:Atg3 UTSW 16 45175261 missense probably benign 0.07
R3743:Atg3 UTSW 16 45178228 critical splice acceptor site probably null
R5047:Atg3 UTSW 16 45178232 missense probably benign 0.00
R6696:Atg3 UTSW 16 45175281 missense possibly damaging 0.93
R7276:Atg3 UTSW 16 45162442 missense possibly damaging 0.70
R8072:Atg3 UTSW 16 45187685 missense probably damaging 1.00
R8501:Atg3 UTSW 16 45182931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACGTGAGGCCTTAGGTG -3'
(R):5'- TTCACTCTAGTGGAAGCGGG -3'

Sequencing Primer
(F):5'- TTCAGTGGAGCTCCGGG -3'
(R):5'- GGAAGCCAGCAAGCCTTG -3'
Posted On2016-07-06