Incidental Mutation 'R5204:Klhl5'
ID398331
Institutional Source Beutler Lab
Gene Symbol Klhl5
Ensembl Gene ENSMUSG00000054920
Gene Namekelch-like 5
Synonyms
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location65107539-65168188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65131438 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 14 (L14F)
Ref Sequence ENSEMBL: ENSMUSP00000144732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101191] [ENSMUST00000204097] [ENSMUST00000204348]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031089
AA Change: L14F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031089
Gene: ENSMUSG00000054920
AA Change: L14F

DomainStartEndE-ValueType
BTB 111 209 1.32e-15 SMART
BACK 214 315 7.85e-36 SMART
Kelch 360 406 1.12e-11 SMART
Kelch 407 453 3.2e-16 SMART
Kelch 454 500 1.51e-12 SMART
Kelch 501 547 4.6e-17 SMART
Kelch 548 600 2.84e-8 SMART
Kelch 601 647 1.83e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101191
AA Change: L14F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098752
Gene: ENSMUSG00000054920
AA Change: L14F

DomainStartEndE-ValueType
low complexity region 114 137 N/A INTRINSIC
BTB 173 270 1.5e-28 SMART
BACK 275 376 7.85e-36 SMART
Kelch 421 467 1.12e-11 SMART
Kelch 468 514 3.2e-16 SMART
Kelch 515 561 1.51e-12 SMART
Kelch 562 608 4.6e-17 SMART
Kelch 609 661 2.84e-8 SMART
Kelch 662 708 1.83e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203561
Predicted Effect probably benign
Transcript: ENSMUST00000204097
SMART Domains Protein: ENSMUSP00000144976
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
BTB 33 130 1.5e-28 SMART
BACK 135 236 7.85e-36 SMART
Kelch 281 327 1.12e-11 SMART
Kelch 328 374 3.2e-16 SMART
Kelch 375 421 1.51e-12 SMART
Kelch 422 468 4.6e-17 SMART
Kelch 469 521 2.84e-8 SMART
Kelch 522 568 1.83e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204348
AA Change: L14F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144732
Gene: ENSMUSG00000054920
AA Change: L14F

DomainStartEndE-ValueType
BTB 111 209 1.32e-15 SMART
BACK 214 315 7.85e-36 SMART
Kelch 360 406 1.12e-11 SMART
Kelch 407 453 3.2e-16 SMART
Kelch 454 500 1.51e-12 SMART
Kelch 501 547 4.6e-17 SMART
Kelch 548 600 2.84e-8 SMART
Kelch 601 647 1.83e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204829
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Abt1 G A 13: 23,422,668 R88C probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Ccdc57 A G 11: 120,886,062 V504A possibly damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clec4b1 T A 6: 123,071,535 *210R probably null Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Olfr609 C T 7: 103,492,540 V113M probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Rufy1 C T 11: 50,406,434 R397Q probably damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tmem30c T C 16: 57,270,022 N274S possibly damaging Het
Tor3a A G 1: 156,655,700 L384P probably damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Klhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Klhl5 APN 5 65148800 missense probably damaging 0.98
IGL02700:Klhl5 APN 5 65131430 nonsense probably null
R0064:Klhl5 UTSW 5 65141288 missense probably benign 0.13
R0142:Klhl5 UTSW 5 65143350 nonsense probably null
R0783:Klhl5 UTSW 5 65156253 splice site probably benign
R0828:Klhl5 UTSW 5 65162792 missense probably damaging 1.00
R1160:Klhl5 UTSW 5 65141340 missense probably benign 0.13
R1181:Klhl5 UTSW 5 65162885 missense probably damaging 0.99
R1611:Klhl5 UTSW 5 65164649 missense probably benign 0.00
R1903:Klhl5 UTSW 5 65166987 missense probably benign 0.37
R4880:Klhl5 UTSW 5 65158901 missense probably damaging 1.00
R4961:Klhl5 UTSW 5 65152690 intron probably benign
R5389:Klhl5 UTSW 5 65141282 missense possibly damaging 0.76
R5921:Klhl5 UTSW 5 65162956 missense probably damaging 0.96
R6769:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R6771:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R7008:Klhl5 UTSW 5 65143249 missense probably benign 0.02
R7214:Klhl5 UTSW 5 65131755 missense probably benign
R7227:Klhl5 UTSW 5 65141288 missense probably benign 0.00
R7239:Klhl5 UTSW 5 65161186 missense probably damaging 1.00
R7400:Klhl5 UTSW 5 65148590 missense possibly damaging 0.81
R7796:Klhl5 UTSW 5 65164622 missense probably damaging 1.00
X0009:Klhl5 UTSW 5 65162921 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTGTTCCACCGCGTTCATC -3'
(R):5'- TGGACCTTCGGTAACCAATGG -3'

Sequencing Primer
(F):5'- ACCGCGTTCATCTTTATTCATTAC -3'
(R):5'- TTCGGTAACCAATGGAAGCC -3'
Posted On2016-07-06