Incidental Mutation 'R5204:Clec4b1'
ID398338
Institutional Source Beutler Lab
Gene Symbol Clec4b1
Ensembl Gene ENSMUSG00000030147
Gene NameC-type lectin domain family 4, member b1
SynonymsmDcar2, 1810046I24Rik, DCAR, 1810046I24Rik, DCARbeta
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123049962-123071555 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 123071535 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 210 (*210R)
Ref Sequence ENSEMBL: ENSMUSP00000077636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077228] [ENSMUST00000078559]
Predicted Effect probably null
Transcript: ENSMUST00000077228
AA Change: *177R
SMART Domains Protein: ENSMUSP00000076466
Gene: ENSMUSG00000030147
AA Change: *177R

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 45 170 2.95e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078559
AA Change: *210R
SMART Domains Protein: ENSMUSP00000077636
Gene: ENSMUSG00000030147
AA Change: *210R

DomainStartEndE-ValueType
Blast:CLECT 26 71 1e-9 BLAST
CLECT 78 203 2.95e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Abt1 G A 13: 23,422,668 R88C probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Ccdc57 A G 11: 120,886,062 V504A possibly damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klhl5 G T 5: 65,131,438 L14F possibly damaging Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Olfr609 C T 7: 103,492,540 V113M probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Rufy1 C T 11: 50,406,434 R397Q probably damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tmem30c T C 16: 57,270,022 N274S possibly damaging Het
Tor3a A G 1: 156,655,700 L384P probably damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Clec4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02817:Clec4b1 APN 6 123068485 missense possibly damaging 0.83
R0488:Clec4b1 UTSW 6 123071482 missense probably damaging 0.99
R0526:Clec4b1 UTSW 6 123069770 critical splice donor site probably null
R0675:Clec4b1 UTSW 6 123071446 missense probably damaging 0.99
R2374:Clec4b1 UTSW 6 123050638 missense probably damaging 1.00
R2504:Clec4b1 UTSW 6 123065945 missense probably damaging 0.98
R3609:Clec4b1 UTSW 6 123050632 missense probably damaging 0.99
R4062:Clec4b1 UTSW 6 123068484 missense probably benign 0.03
R4081:Clec4b1 UTSW 6 123069774 splice site probably null
R4865:Clec4b1 UTSW 6 123068469 missense possibly damaging 0.84
R5172:Clec4b1 UTSW 6 123071455 missense probably benign 0.34
R5757:Clec4b1 UTSW 6 123069754 nonsense probably null
R6129:Clec4b1 UTSW 6 123068502 missense possibly damaging 0.50
R7598:Clec4b1 UTSW 6 123071468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGGTCCAGTTTTCCAG -3'
(R):5'- TTTATGACAGAATAGGTGGGTAAATGC -3'

Sequencing Primer
(F):5'- CATTGTAGGAATCACCCTGATGC -3'
(R):5'- TGCACAAGGATATATGTGGGCC -3'
Posted On2016-07-06