Incidental Mutation 'R5236:Rag2'
ID398345
Institutional Source Beutler Lab
Gene Symbol Rag2
Ensembl Gene ENSMUSG00000032864
Gene Namerecombination activating gene 2
SynonymsRag-2
MMRRC Submission 044393-MU
Accession Numbers

MGI:97849

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5236 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101624718-101632529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101629660 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 105 (D105V)
Ref Sequence ENSEMBL: ENSMUSP00000106858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044031] [ENSMUST00000099682] [ENSMUST00000111227] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722]
Predicted Effect probably damaging
Transcript: ENSMUST00000044031
AA Change: D105V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038204
Gene: ENSMUSG00000032864
AA Change: D105V

DomainStartEndE-ValueType
Pfam:RAG2 51 389 3.5e-179 PFAM
Pfam:RAG2_PHD 414 491 7.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099682
Predicted Effect probably damaging
Transcript: ENSMUST00000111227
AA Change: D105V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106858
Gene: ENSMUSG00000032864
AA Change: D105V

DomainStartEndE-ValueType
Pfam:RAG2 51 389 6.7e-193 PFAM
Pfam:RAG2_PHD 414 491 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111231
Predicted Effect probably benign
Transcript: ENSMUST00000128898
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(14)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,921 I180N possibly damaging Het
Actl9 T C 17: 33,434,099 S378P probably damaging Het
Agrn A T 4: 156,178,858 C263S possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Arid4b A G 13: 14,126,449 probably null Het
BC067074 A G 13: 113,366,220 Y153C probably benign Het
Bin2 T C 15: 100,662,534 N49D probably damaging Het
Ccdc39 T C 3: 33,830,102 T364A probably damaging Het
Cdcp1 A T 9: 123,185,193 V172D probably damaging Het
Cdh23 A G 10: 60,312,572 L2670P probably damaging Het
Cmtm4 G C 8: 104,357,746 F105L probably damaging Het
Ctsa G A 2: 164,838,911 V453M probably damaging Het
Cyp3a59 A G 5: 146,102,825 I303V probably benign Het
Cyp4f17 T C 17: 32,520,632 probably null Het
Dst C T 1: 34,164,417 R447C probably damaging Het
E2f7 C T 10: 110,767,209 P362S probably damaging Het
Fbxw9 A G 8: 85,066,345 T407A probably damaging Het
Fyb2 T C 4: 104,948,760 S346P probably benign Het
Git2 T A 5: 114,767,172 I75L probably damaging Het
H2-DMa T A 17: 34,137,939 L137Q probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrg T C 16: 22,961,513 probably benign Het
Htr7 A T 19: 36,056,769 I162N probably damaging Het
Itpripl1 A T 2: 127,141,850 F117L probably damaging Het
Kri1 T C 9: 21,275,941 Y392C probably damaging Het
Krt27 A C 11: 99,350,815 S87A possibly damaging Het
Lama1 T C 17: 67,804,492 V2246A probably benign Het
Lcn2 A T 2: 32,385,961 M119K probably benign Het
Lrp2 T C 2: 69,456,819 probably null Het
Lrp6 T C 6: 134,511,264 N290D probably damaging Het
Macf1 T C 4: 123,397,821 E2517G probably damaging Het
Melk G A 4: 44,344,959 C363Y probably benign Het
Mettl22 T A 16: 8,488,733 L351* probably null Het
Mms22l A G 4: 24,588,347 Q953R probably benign Het
Ndufaf7 T C 17: 78,939,631 S107P probably benign Het
Olfr446 A C 6: 42,927,781 R183S probably benign Het
Olfr459 C A 6: 41,772,111 G63C probably benign Het
Opa3 A G 7: 19,244,757 Y49C probably damaging Het
Pabpn1 T A 14: 54,894,942 M145K possibly damaging Het
Plce1 A C 19: 38,770,347 M1982L probably benign Het
Ppcdc A C 9: 57,414,654 I201S probably benign Het
Rnf130 C T 11: 50,095,978 T383I probably damaging Het
Sgip1 T G 4: 102,927,587 probably null Het
Slc23a2 T A 2: 132,075,584 I245F probably damaging Het
Slc4a9 A G 18: 36,530,847 Y308C probably benign Het
Slc7a15 C T 12: 8,539,005 V181M probably benign Het
Sprr2b G A 3: 92,317,636 C63Y unknown Het
Stpg2 A T 3: 139,232,223 Y181F probably damaging Het
Sult2a5 A T 7: 13,665,049 T194S probably benign Het
Tbx15 A T 3: 99,352,046 Q411L possibly damaging Het
Tln2 T A 9: 67,365,923 E427V probably damaging Het
Trpv4 A C 5: 114,622,795 V825G possibly damaging Het
Trrap A G 5: 144,817,786 I1968V probably benign Het
Ttn G A 2: 76,788,802 L16078F probably damaging Het
Unc45b T A 11: 82,915,062 F132I possibly damaging Het
Unc79 T A 12: 103,094,395 probably null Het
Vmn2r71 A T 7: 85,623,669 N564Y probably damaging Het
Zfp638 G T 6: 83,976,575 E1221* probably null Het
Zfp934 A T 13: 62,517,713 H371Q probably damaging Het
Zranb3 A G 1: 128,040,989 L63P probably damaging Het
Other mutations in Rag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Rag2 APN 2 101630617 missense probably benign 0.00
IGL01358:Rag2 APN 2 101630020 missense possibly damaging 0.95
IGL01774:Rag2 APN 2 101630047 missense probably damaging 1.00
IGL02267:Rag2 APN 2 101630031 missense probably damaging 1.00
IGL02507:Rag2 APN 2 101630710 missense probably damaging 0.99
IGL02615:Rag2 APN 2 101629568 nonsense probably null
IGL02690:Rag2 APN 2 101629494 missense probably benign 0.00
IGL03087:Rag2 APN 2 101630214 missense probably benign 0.00
IGL03261:Rag2 APN 2 101630263 missense probably damaging 0.96
billfold UTSW 2 101630773 missense probably damaging 1.00
excambiar UTSW 2 101630776 missense probably damaging 0.99
R7917_rag2_125 UTSW 2 101629695 missense probably damaging 1.00
snowcock UTSW 2 101630603 missense probably damaging 1.00
woodcock UTSW 2 101630119 missense probably damaging 0.98
R0266:Rag2 UTSW 2 101630603 missense probably damaging 1.00
R0284:Rag2 UTSW 2 101630119 missense probably damaging 0.98
R1250:Rag2 UTSW 2 101630439 missense probably damaging 0.96
R1520:Rag2 UTSW 2 101630131 missense probably damaging 0.99
R1641:Rag2 UTSW 2 101629615 missense probably benign 0.22
R2260:Rag2 UTSW 2 101630238 missense probably benign 0.00
R2571:Rag2 UTSW 2 101629967 missense probably damaging 0.99
R3441:Rag2 UTSW 2 101630300 missense probably damaging 0.99
R3752:Rag2 UTSW 2 101630776 missense probably damaging 0.99
R4894:Rag2 UTSW 2 101629677 missense probably damaging 1.00
R5197:Rag2 UTSW 2 101630740 missense probably damaging 1.00
R6815:Rag2 UTSW 2 101630555 missense probably damaging 0.99
R7365:Rag2 UTSW 2 101630773 missense probably damaging 1.00
R7917:Rag2 UTSW 2 101629695 missense probably damaging 1.00
X0027:Rag2 UTSW 2 101630373 missense probably damaging 1.00
Z31818:Rag2 UTSW 2 101630805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTTCTTCTTTGGCCAGAAAGG -3'
(R):5'- GCATGTATGAACGTCCTCCAAAG -3'

Sequencing Primer
(F):5'- GCCTAAGAGATCCTGTCCTACTGG -3'
(R):5'- TGTATGAACGTCCTCCAAAGAGAAC -3'
Posted On2016-07-06