Incidental Mutation 'R5204:Usp15'
ID 398354
Institutional Source Beutler Lab
Gene Symbol Usp15
Ensembl Gene ENSMUSG00000020124
Gene Name ubiquitin specific peptidase 15
Synonyms Gcap18, E430033I05Rik, 4921514G19Rik
MMRRC Submission 042779-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5204 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 122940911-123032900 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122949545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 908 (S908R)
Ref Sequence ENSEMBL: ENSMUSP00000020334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]
AlphaFold Q8R5H1
Predicted Effect probably benign
Transcript: ENSMUST00000020334
AA Change: S908R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124
AA Change: S908R

DomainStartEndE-ValueType
DUSP 23 121 1.5e-46 SMART
Pfam:Ubiquitin_3 135 222 3.7e-38 PFAM
low complexity region 242 262 N/A INTRINSIC
Pfam:UCH 288 930 6.8e-86 PFAM
Pfam:UCH_1 289 506 1.1e-5 PFAM
Pfam:USP7_C2 460 608 2e-7 PFAM
Pfam:UCH_1 756 912 1.3e-11 PFAM
low complexity region 959 976 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219937
Predicted Effect probably benign
Transcript: ENSMUST00000220377
AA Change: S937R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A T 11: 101,297,752 (GRCm39) L532Q probably damaging Het
Abt1 G A 13: 23,606,838 (GRCm39) R88C probably damaging Het
Aopep G A 13: 63,180,904 (GRCm39) V289I probably benign Het
Arhgef7 T A 8: 11,850,775 (GRCm39) L129* probably null Het
Arid1b T C 17: 5,393,316 (GRCm39) V2282A probably damaging Het
Bivm G C 1: 44,177,738 (GRCm39) G346A probably damaging Het
Cav1 T C 6: 17,339,254 (GRCm39) L102P probably damaging Het
Ccdc57 A G 11: 120,776,888 (GRCm39) V504A possibly damaging Het
Cd7 A T 11: 120,928,860 (GRCm39) probably null Het
Cdh3 T C 8: 107,270,871 (GRCm39) V508A probably benign Het
Chrd A T 16: 20,554,822 (GRCm39) I413F probably benign Het
Clec4b1 T A 6: 123,048,494 (GRCm39) *210R probably null Het
Clock A T 5: 76,391,017 (GRCm39) probably null Het
Col4a2 T A 8: 11,448,651 (GRCm39) probably null Het
Gpx7 T C 4: 108,260,512 (GRCm39) T95A probably benign Het
Hivep3 T A 4: 119,961,053 (GRCm39) probably null Het
Hrc A G 7: 44,985,128 (GRCm39) Y93C possibly damaging Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Klhl5 G T 5: 65,288,781 (GRCm39) L14F possibly damaging Het
Mcm6 A G 1: 128,261,375 (GRCm39) L743P probably benign Het
Nrxn1 A T 17: 90,469,792 (GRCm39) F57Y probably damaging Het
Or51af1 C T 7: 103,141,747 (GRCm39) V113M probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdh20 G T 14: 88,706,351 (GRCm39) D316E probably damaging Het
Pcdhb12 T A 18: 37,569,142 (GRCm39) V96E probably damaging Het
Pi4ka A T 16: 17,176,909 (GRCm39) L346M possibly damaging Het
Pkhd1l1 A C 15: 44,410,437 (GRCm39) N2648T possibly damaging Het
Rufy1 C T 11: 50,297,261 (GRCm39) R397Q probably damaging Het
Sema5a G T 15: 32,686,793 (GRCm39) M968I probably benign Het
Slc33a1 A G 3: 63,871,167 (GRCm39) Y149H probably damaging Het
Tln2 T A 9: 67,261,764 (GRCm39) R658S probably benign Het
Tmem30c T C 16: 57,090,385 (GRCm39) N274S possibly damaging Het
Tor3a A G 1: 156,483,270 (GRCm39) L384P probably damaging Het
Trpm3 T A 19: 22,425,705 (GRCm39) L20* probably null Het
Ttn T A 2: 76,560,556 (GRCm39) I20955F probably damaging Het
Zfp866 A G 8: 70,218,690 (GRCm39) L310P probably damaging Het
Other mutations in Usp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Usp15 APN 10 122,949,501 (GRCm39) missense probably benign 0.00
IGL02148:Usp15 APN 10 122,963,742 (GRCm39) missense probably damaging 1.00
IGL02737:Usp15 APN 10 122,966,937 (GRCm39) missense probably damaging 1.00
IGL03054:Usp15 APN 10 122,961,836 (GRCm39) splice site probably benign
IGL03163:Usp15 APN 10 123,007,049 (GRCm39) missense probably damaging 0.96
R1755:Usp15 UTSW 10 122,968,949 (GRCm39) missense probably damaging 0.98
R1981:Usp15 UTSW 10 122,960,946 (GRCm39) splice site probably benign
R2049:Usp15 UTSW 10 122,955,042 (GRCm39) missense probably damaging 1.00
R3037:Usp15 UTSW 10 122,999,522 (GRCm39) missense probably damaging 1.00
R3698:Usp15 UTSW 10 123,017,643 (GRCm39) missense probably damaging 1.00
R3828:Usp15 UTSW 10 123,032,775 (GRCm39) missense possibly damaging 0.95
R3845:Usp15 UTSW 10 122,955,040 (GRCm39) missense probably damaging 1.00
R4838:Usp15 UTSW 10 122,963,662 (GRCm39) missense probably damaging 0.99
R4954:Usp15 UTSW 10 122,967,303 (GRCm39) missense probably damaging 1.00
R5274:Usp15 UTSW 10 123,004,256 (GRCm39) missense probably damaging 1.00
R5387:Usp15 UTSW 10 122,967,191 (GRCm39) missense probably damaging 0.96
R5474:Usp15 UTSW 10 122,963,950 (GRCm39) missense probably damaging 1.00
R5501:Usp15 UTSW 10 123,011,804 (GRCm39) missense probably damaging 0.99
R5665:Usp15 UTSW 10 122,966,892 (GRCm39) nonsense probably null
R5846:Usp15 UTSW 10 123,017,647 (GRCm39) missense probably damaging 1.00
R5850:Usp15 UTSW 10 122,960,417 (GRCm39) critical splice donor site probably null
R6163:Usp15 UTSW 10 123,004,210 (GRCm39) missense probably damaging 1.00
R6735:Usp15 UTSW 10 123,004,272 (GRCm39) missense possibly damaging 0.86
R6828:Usp15 UTSW 10 122,963,894 (GRCm39) missense probably damaging 1.00
R7170:Usp15 UTSW 10 123,007,100 (GRCm39) missense probably damaging 1.00
R7197:Usp15 UTSW 10 122,966,910 (GRCm39) missense possibly damaging 0.92
R7351:Usp15 UTSW 10 122,968,904 (GRCm39) missense probably damaging 1.00
R7368:Usp15 UTSW 10 123,032,798 (GRCm39) missense possibly damaging 0.86
R7447:Usp15 UTSW 10 123,011,786 (GRCm39) missense probably damaging 1.00
R8099:Usp15 UTSW 10 122,982,826 (GRCm39) missense possibly damaging 0.87
R8169:Usp15 UTSW 10 122,961,798 (GRCm39) missense
R8316:Usp15 UTSW 10 122,959,848 (GRCm39) missense
R8795:Usp15 UTSW 10 122,988,953 (GRCm39) missense probably benign 0.00
R9005:Usp15 UTSW 10 122,982,703 (GRCm39) missense possibly damaging 0.89
R9023:Usp15 UTSW 10 122,961,498 (GRCm39) missense possibly damaging 0.85
R9156:Usp15 UTSW 10 122,949,553 (GRCm39) missense probably benign 0.13
R9198:Usp15 UTSW 10 123,004,143 (GRCm39) missense probably damaging 1.00
R9278:Usp15 UTSW 10 123,007,112 (GRCm39) missense probably damaging 0.96
R9592:Usp15 UTSW 10 122,999,522 (GRCm39) missense probably damaging 1.00
Z1176:Usp15 UTSW 10 123,032,866 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACTTCTGTTTCATGTGGTGATAAC -3'
(R):5'- GTAGCTTCCATGTGATCATGTG -3'

Sequencing Primer
(F):5'- GGTGATAACTTCATCTCCATAGACAC -3'
(R):5'- TGATACCGTAGCAGCTGT -3'
Posted On 2016-07-06