Incidental Mutation 'R5204:Rufy1'
ID398358
Institutional Source Beutler Lab
Gene Symbol Rufy1
Ensembl Gene ENSMUSG00000020375
Gene NameRUN and FYVE domain containing 1
SynonymsZFYVE12, 3000002E04Rik, Rabip4
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50389286-50431125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50406434 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 397 (R397Q)
Ref Sequence ENSEMBL: ENSMUSP00000020643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020643]
Predicted Effect probably damaging
Transcript: ENSMUST00000020643
AA Change: R397Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020643
Gene: ENSMUSG00000020375
AA Change: R397Q

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 83 111 N/A INTRINSIC
RUN 211 273 1.21e-21 SMART
coiled coil region 324 384 N/A INTRINSIC
coiled coil region 409 621 N/A INTRINSIC
FYVE 638 705 1.24e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135508
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Abt1 G A 13: 23,422,668 R88C probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Ccdc57 A G 11: 120,886,062 V504A possibly damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clec4b1 T A 6: 123,071,535 *210R probably null Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klhl5 G T 5: 65,131,438 L14F possibly damaging Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Olfr609 C T 7: 103,492,540 V113M probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tmem30c T C 16: 57,270,022 N274S possibly damaging Het
Tor3a A G 1: 156,655,700 L384P probably damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Rufy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Rufy1 APN 11 50392023 missense probably damaging 1.00
IGL01640:Rufy1 APN 11 50390378 unclassified probably benign
IGL01829:Rufy1 APN 11 50416244 nonsense probably null
IGL02559:Rufy1 APN 11 50420483 missense probably damaging 1.00
IGL03409:Rufy1 APN 11 50406483 missense probably benign 0.00
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0193:Rufy1 UTSW 11 50389852 missense probably benign 0.12
R1028:Rufy1 UTSW 11 50414598 intron probably null
R1591:Rufy1 UTSW 11 50394928 missense probably damaging 1.00
R1818:Rufy1 UTSW 11 50414572 missense probably benign 0.43
R1952:Rufy1 UTSW 11 50406406 missense probably benign 0.01
R2228:Rufy1 UTSW 11 50397784 splice site probably null
R2982:Rufy1 UTSW 11 50419708 missense possibly damaging 0.77
R4837:Rufy1 UTSW 11 50401493 missense probably damaging 0.96
R4874:Rufy1 UTSW 11 50406450 missense possibly damaging 0.80
R4959:Rufy1 UTSW 11 50401488 missense probably benign
R4968:Rufy1 UTSW 11 50410607 missense probably benign 0.01
R5426:Rufy1 UTSW 11 50421734 missense probably damaging 1.00
R5966:Rufy1 UTSW 11 50401488 missense probably benign
R6129:Rufy1 UTSW 11 50417248 missense probably damaging 0.99
R6930:Rufy1 UTSW 11 50398380 missense probably benign 0.05
R7073:Rufy1 UTSW 11 50404463 missense probably benign 0.05
R7462:Rufy1 UTSW 11 50407828 missense possibly damaging 0.93
R7646:Rufy1 UTSW 11 50410609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTTCCGGCTTTCTAGGAG -3'
(R):5'- CTGATGGCATCCTTCATCTTTCAGG -3'

Sequencing Primer
(F):5'- CTTTCTAGGAGCGCCAGC -3'
(R):5'- GCCCTAAGATCCAGCATGTTTAAAG -3'
Posted On2016-07-06