Mutagenetix > Incidental Mutation

Incidental Mutation 'R5236:Tbx15'

398359

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

044393-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R5236 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99352046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 411 (Q411L)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: Q411L

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: Q411L

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9630041A04Rik	T	A	9: 101,942,921	I180N	possibly damaging	Het
Actl9	T	C	17: 33,434,099	S378P	probably damaging	Het
Agrn	A	T	4: 156,178,858	C263S	possibly damaging	Het
Ahnak	A	G	19: 9,000,684	I56V	possibly damaging	Het
Arid4b	A	G	13: 14,126,449		probably null	Het
BC067074	A	G	13: 113,366,220	Y153C	probably benign	Het
Bin2	T	C	15: 100,662,534	N49D	probably damaging	Het
Ccdc39	T	C	3: 33,830,102	T364A	probably damaging	Het
Cdcp1	A	T	9: 123,185,193	V172D	probably damaging	Het
Cdh23	A	G	10: 60,312,572	L2670P	probably damaging	Het
Cmtm4	G	C	8: 104,357,746	F105L	probably damaging	Het
Ctsa	G	A	2: 164,838,911	V453M	probably damaging	Het
Cyp3a59	A	G	5: 146,102,825	I303V	probably benign	Het
Cyp4f17	T	C	17: 32,520,632		probably null	Het
Dst	C	T	1: 34,164,417	R447C	probably damaging	Het
E2f7	C	T	10: 110,767,209	P362S	probably damaging	Het
Fbxw9	A	G	8: 85,066,345	T407A	probably damaging	Het
Fyb2	T	C	4: 104,948,760	S346P	probably benign	Het
Git2	T	A	5: 114,767,172	I75L	probably damaging	Het
H2-DMa	T	A	17: 34,137,939	L137Q	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrg	T	C	16: 22,961,513		probably benign	Het
Htr7	A	T	19: 36,056,769	I162N	probably damaging	Het
Itpripl1	A	T	2: 127,141,850	F117L	probably damaging	Het
Kri1	T	C	9: 21,275,941	Y392C	probably damaging	Het
Krt27	A	C	11: 99,350,815	S87A	possibly damaging	Het
Lama1	T	C	17: 67,804,492	V2246A	probably benign	Het
Lcn2	A	T	2: 32,385,961	M119K	probably benign	Het
Lrp2	T	C	2: 69,456,819		probably null	Het
Lrp6	T	C	6: 134,511,264	N290D	probably damaging	Het
Macf1	T	C	4: 123,397,821	E2517G	probably damaging	Het
Melk	G	A	4: 44,344,959	C363Y	probably benign	Het
Mettl22	T	A	16: 8,488,733	L351*	probably null	Het
Mms22l	A	G	4: 24,588,347	Q953R	probably benign	Het
Ndufaf7	T	C	17: 78,939,631	S107P	probably benign	Het
Olfr446	A	C	6: 42,927,781	R183S	probably benign	Het
Olfr459	C	A	6: 41,772,111	G63C	probably benign	Het
Opa3	A	G	7: 19,244,757	Y49C	probably damaging	Het
Pabpn1	T	A	14: 54,894,942	M145K	possibly damaging	Het
Plce1	A	C	19: 38,770,347	M1982L	probably benign	Het
Ppcdc	A	C	9: 57,414,654	I201S	probably benign	Het
Rag2	A	T	2: 101,629,660	D105V	probably damaging	Het
Rnf130	C	T	11: 50,095,978	T383I	probably damaging	Het
Sgip1	T	G	4: 102,927,587		probably null	Het
Slc23a2	T	A	2: 132,075,584	I245F	probably damaging	Het
Slc4a9	A	G	18: 36,530,847	Y308C	probably benign	Het
Slc7a15	C	T	12: 8,539,005	V181M	probably benign	Het
Sprr2b	G	A	3: 92,317,636	C63Y	unknown	Het
Stpg2	A	T	3: 139,232,223	Y181F	probably damaging	Het
Sult2a5	A	T	7: 13,665,049	T194S	probably benign	Het
Tln2	T	A	9: 67,365,923	E427V	probably damaging	Het
Trpv4	A	C	5: 114,622,795	V825G	possibly damaging	Het
Trrap	A	G	5: 144,817,786	I1968V	probably benign	Het
Ttn	G	A	2: 76,788,802	L16078F	probably damaging	Het
Unc45b	T	A	11: 82,915,062	F132I	possibly damaging	Het
Unc79	T	A	12: 103,094,395		probably null	Het
Vmn2r71	A	T	7: 85,623,669	N564Y	probably damaging	Het
Zfp638	G	T	6: 83,976,575	E1221*	probably null	Het
Zfp934	A	T	13: 62,517,713	H371Q	probably damaging	Het
Zranb3	A	G	1: 128,040,989	L63P	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTACAGGTACTTCTCCAACC -3'
(R):5'- TGCCTGCCTGCATGACATAC -3'

Sequencing Primer
(F):5'- GTACAGGTACTTCTCCAACCACCTC -3'
(R):5'- TGCCTGCATGACATACTGAAACTG -3'

Posted On

2016-07-06