Incidental Mutation 'R5236:Stpg2'
ID398361
Institutional Source Beutler Lab
Gene Symbol Stpg2
Ensembl Gene ENSMUSG00000047940
Gene Namesperm tail PG rich repeat containing 2
SynonymsLOC381476, B930007M17Rik
MMRRC Submission 044393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5236 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location139205694-139710299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139232223 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 181 (Y181F)
Ref Sequence ENSEMBL: ENSMUSP00000101846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062306] [ENSMUST00000106239]
Predicted Effect probably damaging
Transcript: ENSMUST00000062306
AA Change: Y181F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051539
Gene: ENSMUSG00000047940
AA Change: Y181F

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 20 50 1.1e1 PFAM
Pfam:SHIPPO-rpt 62 92 1.3e1 PFAM
Pfam:SHIPPO-rpt 97 127 9.1e1 PFAM
Pfam:SHIPPO-rpt 162 193 1.3e2 PFAM
Pfam:SHIPPO-rpt 200 235 1.7e0 PFAM
Pfam:SHIPPO-rpt 249 285 1.2e-2 PFAM
Pfam:SHIPPO-rpt 292 315 3.2e1 PFAM
Pfam:SHIPPO-rpt 334 371 2.1e0 PFAM
Pfam:SHIPPO-rpt 421 462 3.8e0 PFAM
Pfam:SHIPPO-rpt 471 497 2.9e1 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106239
AA Change: Y181F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101846
Gene: ENSMUSG00000047940
AA Change: Y181F

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 200 220 6.9e-1 PFAM
Pfam:SHIPPO-rpt 249 285 8.8e-2 PFAM
Pfam:SHIPPO-rpt 334 371 5.4e-2 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,921 I180N possibly damaging Het
Actl9 T C 17: 33,434,099 S378P probably damaging Het
Agrn A T 4: 156,178,858 C263S possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Arid4b A G 13: 14,126,449 probably null Het
BC067074 A G 13: 113,366,220 Y153C probably benign Het
Bin2 T C 15: 100,662,534 N49D probably damaging Het
Ccdc39 T C 3: 33,830,102 T364A probably damaging Het
Cdcp1 A T 9: 123,185,193 V172D probably damaging Het
Cdh23 A G 10: 60,312,572 L2670P probably damaging Het
Cmtm4 G C 8: 104,357,746 F105L probably damaging Het
Ctsa G A 2: 164,838,911 V453M probably damaging Het
Cyp3a59 A G 5: 146,102,825 I303V probably benign Het
Cyp4f17 T C 17: 32,520,632 probably null Het
Dst C T 1: 34,164,417 R447C probably damaging Het
E2f7 C T 10: 110,767,209 P362S probably damaging Het
Fbxw9 A G 8: 85,066,345 T407A probably damaging Het
Fyb2 T C 4: 104,948,760 S346P probably benign Het
Git2 T A 5: 114,767,172 I75L probably damaging Het
H2-DMa T A 17: 34,137,939 L137Q probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrg T C 16: 22,961,513 probably benign Het
Htr7 A T 19: 36,056,769 I162N probably damaging Het
Itpripl1 A T 2: 127,141,850 F117L probably damaging Het
Kri1 T C 9: 21,275,941 Y392C probably damaging Het
Krt27 A C 11: 99,350,815 S87A possibly damaging Het
Lama1 T C 17: 67,804,492 V2246A probably benign Het
Lcn2 A T 2: 32,385,961 M119K probably benign Het
Lrp2 T C 2: 69,456,819 probably null Het
Lrp6 T C 6: 134,511,264 N290D probably damaging Het
Macf1 T C 4: 123,397,821 E2517G probably damaging Het
Melk G A 4: 44,344,959 C363Y probably benign Het
Mettl22 T A 16: 8,488,733 L351* probably null Het
Mms22l A G 4: 24,588,347 Q953R probably benign Het
Ndufaf7 T C 17: 78,939,631 S107P probably benign Het
Olfr446 A C 6: 42,927,781 R183S probably benign Het
Olfr459 C A 6: 41,772,111 G63C probably benign Het
Opa3 A G 7: 19,244,757 Y49C probably damaging Het
Pabpn1 T A 14: 54,894,942 M145K possibly damaging Het
Plce1 A C 19: 38,770,347 M1982L probably benign Het
Ppcdc A C 9: 57,414,654 I201S probably benign Het
Rag2 A T 2: 101,629,660 D105V probably damaging Het
Rnf130 C T 11: 50,095,978 T383I probably damaging Het
Sgip1 T G 4: 102,927,587 probably null Het
Slc23a2 T A 2: 132,075,584 I245F probably damaging Het
Slc4a9 A G 18: 36,530,847 Y308C probably benign Het
Slc7a15 C T 12: 8,539,005 V181M probably benign Het
Sprr2b G A 3: 92,317,636 C63Y unknown Het
Sult2a5 A T 7: 13,665,049 T194S probably benign Het
Tbx15 A T 3: 99,352,046 Q411L possibly damaging Het
Tln2 T A 9: 67,365,923 E427V probably damaging Het
Trpv4 A C 5: 114,622,795 V825G possibly damaging Het
Trrap A G 5: 144,817,786 I1968V probably benign Het
Ttn G A 2: 76,788,802 L16078F probably damaging Het
Unc45b T A 11: 82,915,062 F132I possibly damaging Het
Unc79 T A 12: 103,094,395 probably null Het
Vmn2r71 A T 7: 85,623,669 N564Y probably damaging Het
Zfp638 G T 6: 83,976,575 E1221* probably null Het
Zfp934 A T 13: 62,517,713 H371Q probably damaging Het
Zranb3 A G 1: 128,040,989 L63P probably damaging Het
Other mutations in Stpg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Stpg2 APN 3 139419874 splice site probably benign
IGL01505:Stpg2 APN 3 139317453 missense probably benign 0.02
IGL01649:Stpg2 APN 3 139419862 missense probably damaging 1.00
IGL03264:Stpg2 APN 3 139309209 missense possibly damaging 0.72
PIT4687001:Stpg2 UTSW 3 139215265 missense possibly damaging 0.89
R0053:Stpg2 UTSW 3 139212321 missense probably benign 0.00
R0099:Stpg2 UTSW 3 139243193 splice site probably benign
R0417:Stpg2 UTSW 3 139218321 missense probably damaging 1.00
R1646:Stpg2 UTSW 3 139419702 splice site probably benign
R1719:Stpg2 UTSW 3 139232199 missense probably benign 0.11
R1791:Stpg2 UTSW 3 139317401 missense probably benign 0.00
R1799:Stpg2 UTSW 3 139419781 missense probably damaging 1.00
R1912:Stpg2 UTSW 3 139522981 splice site probably null
R1974:Stpg2 UTSW 3 139309183 nonsense probably null
R3725:Stpg2 UTSW 3 139317477 missense probably benign 0.00
R3727:Stpg2 UTSW 3 139298496 missense probably damaging 1.00
R4225:Stpg2 UTSW 3 139215292 missense probably damaging 0.97
R4694:Stpg2 UTSW 3 139317416 missense possibly damaging 0.94
R4698:Stpg2 UTSW 3 139309229 missense probably damaging 1.00
R4879:Stpg2 UTSW 3 139215373 missense probably benign 0.03
R5476:Stpg2 UTSW 3 139243138 missense probably benign 0.03
R5567:Stpg2 UTSW 3 139419786 missense probably benign 0.22
R6297:Stpg2 UTSW 3 139701671 missense possibly damaging 0.91
R6692:Stpg2 UTSW 3 139522977 critical splice donor site probably null
R7113:Stpg2 UTSW 3 139701774 critical splice donor site probably null
R7154:Stpg2 UTSW 3 139215295 missense probably benign 0.44
R7553:Stpg2 UTSW 3 139218337 missense probably damaging 1.00
R7660:Stpg2 UTSW 3 139701697 missense probably damaging 0.98
R8105:Stpg2 UTSW 3 139243164 missense probably damaging 1.00
R8154:Stpg2 UTSW 3 139309177 missense probably damaging 1.00
R8902:Stpg2 UTSW 3 139298409 missense probably damaging 1.00
RF021:Stpg2 UTSW 3 139212250 critical splice acceptor site probably null
X0009:Stpg2 UTSW 3 139298462 missense probably benign 0.00
X0018:Stpg2 UTSW 3 139243090 missense probably benign 0.44
Z1176:Stpg2 UTSW 3 139701640 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTCAGCGTAGAGAGCCCTCC -3'
(R):5'- AGAGTCCTTTGCACCCACTC -3'

Sequencing Primer
(F):5'- GTAGAGAGCCCTCCCTGACTTTAC -3'
(R):5'- AGGCTGCACTACGTAATCCTG -3'
Posted On2016-07-06