Incidental Mutation 'R5204:Abt1'
ID398366
Institutional Source Beutler Lab
Gene Symbol Abt1
Ensembl Gene ENSMUSG00000036376
Gene Nameactivator of basal transcription 1
Synonyms
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23418361-23423866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23422668 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 88 (R88C)
Ref Sequence ENSEMBL: ENSMUSP00000045888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041782]
Predicted Effect probably damaging
Transcript: ENSMUST00000041782
AA Change: R88C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045888
Gene: ENSMUSG00000036376
AA Change: R88C

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
low complexity region 36 44 N/A INTRINSIC
Blast:RRM 49 141 9e-34 BLAST
SCOP:d1fxla1 50 137 4e-3 SMART
coiled coil region 166 194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Basal transcription of genes by RNA polymerase II requires the interaction of TATA-binding protein (TBP) with the core region of class II promoters. Studies in mouse suggest that the protein encoded by this gene likely activates basal transcription from class II promoters by interaction with TBP and the class II promoter DNA. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Ccdc57 A G 11: 120,886,062 V504A possibly damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clec4b1 T A 6: 123,071,535 *210R probably null Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klhl5 G T 5: 65,131,438 L14F possibly damaging Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Olfr609 C T 7: 103,492,540 V113M probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Rufy1 C T 11: 50,406,434 R397Q probably damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tmem30c T C 16: 57,270,022 N274S possibly damaging Het
Tor3a A G 1: 156,655,700 L384P probably damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Abt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Abt1 APN 13 23423768 missense unknown
IGL01917:Abt1 APN 13 23423789 missense unknown
FR4548:Abt1 UTSW 13 23423711 small deletion probably benign
FR4976:Abt1 UTSW 13 23423711 small deletion probably benign
PIT4486001:Abt1 UTSW 13 23423681 missense possibly damaging 0.87
R0029:Abt1 UTSW 13 23422508 missense possibly damaging 0.85
R2171:Abt1 UTSW 13 23422217 missense probably damaging 1.00
R4082:Abt1 UTSW 13 23422146 missense probably benign 0.00
R5125:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5178:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5947:Abt1 UTSW 13 23422055 missense possibly damaging 0.55
R6562:Abt1 UTSW 13 23423588 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACAGGTCATAACGGAAGG -3'
(R):5'- CCTCTTGACATGCACAACTTGG -3'

Sequencing Primer
(F):5'- TCATAACGGAAGGGGCTGC -3'
(R):5'- CTTGACATGCACAACTTGGAAATGG -3'
Posted On2016-07-06