Incidental Mutation 'R5236:Fyb2'
ID398371
Institutional Source Beutler Lab
Gene Symbol Fyb2
Ensembl Gene ENSMUSG00000078612
Gene NameFYN binding protein 2
Synonyms1700024P16Rik
MMRRC Submission 044393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5236 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location104913456-105016863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104948760 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 346 (S346P)
Ref Sequence ENSEMBL: ENSMUSP00000102415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106803] [ENSMUST00000106804]
Predicted Effect probably benign
Transcript: ENSMUST00000106803
AA Change: S346P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102415
Gene: ENSMUSG00000078612
AA Change: S346P

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 537 549 N/A INTRINSIC
low complexity region 567 578 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
SH3 735 791 3.82e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106804
AA Change: S282P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102416
Gene: ENSMUSG00000078612
AA Change: S282P

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 276 285 N/A INTRINSIC
low complexity region 378 395 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
SH3 671 727 3.82e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,921 I180N possibly damaging Het
Actl9 T C 17: 33,434,099 S378P probably damaging Het
Agrn A T 4: 156,178,858 C263S possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Arid4b A G 13: 14,126,449 probably null Het
BC067074 A G 13: 113,366,220 Y153C probably benign Het
Bin2 T C 15: 100,662,534 N49D probably damaging Het
Ccdc39 T C 3: 33,830,102 T364A probably damaging Het
Cdcp1 A T 9: 123,185,193 V172D probably damaging Het
Cdh23 A G 10: 60,312,572 L2670P probably damaging Het
Cmtm4 G C 8: 104,357,746 F105L probably damaging Het
Ctsa G A 2: 164,838,911 V453M probably damaging Het
Cyp3a59 A G 5: 146,102,825 I303V probably benign Het
Cyp4f17 T C 17: 32,520,632 probably null Het
Dst C T 1: 34,164,417 R447C probably damaging Het
E2f7 C T 10: 110,767,209 P362S probably damaging Het
Fbxw9 A G 8: 85,066,345 T407A probably damaging Het
Git2 T A 5: 114,767,172 I75L probably damaging Het
H2-DMa T A 17: 34,137,939 L137Q probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrg T C 16: 22,961,513 probably benign Het
Htr7 A T 19: 36,056,769 I162N probably damaging Het
Itpripl1 A T 2: 127,141,850 F117L probably damaging Het
Kri1 T C 9: 21,275,941 Y392C probably damaging Het
Krt27 A C 11: 99,350,815 S87A possibly damaging Het
Lama1 T C 17: 67,804,492 V2246A probably benign Het
Lcn2 A T 2: 32,385,961 M119K probably benign Het
Lrp2 T C 2: 69,456,819 probably null Het
Lrp6 T C 6: 134,511,264 N290D probably damaging Het
Macf1 T C 4: 123,397,821 E2517G probably damaging Het
Melk G A 4: 44,344,959 C363Y probably benign Het
Mettl22 T A 16: 8,488,733 L351* probably null Het
Mms22l A G 4: 24,588,347 Q953R probably benign Het
Ndufaf7 T C 17: 78,939,631 S107P probably benign Het
Olfr446 A C 6: 42,927,781 R183S probably benign Het
Olfr459 C A 6: 41,772,111 G63C probably benign Het
Opa3 A G 7: 19,244,757 Y49C probably damaging Het
Pabpn1 T A 14: 54,894,942 M145K possibly damaging Het
Plce1 A C 19: 38,770,347 M1982L probably benign Het
Ppcdc A C 9: 57,414,654 I201S probably benign Het
Rag2 A T 2: 101,629,660 D105V probably damaging Het
Rnf130 C T 11: 50,095,978 T383I probably damaging Het
Sgip1 T G 4: 102,927,587 probably null Het
Slc23a2 T A 2: 132,075,584 I245F probably damaging Het
Slc4a9 A G 18: 36,530,847 Y308C probably benign Het
Slc7a15 C T 12: 8,539,005 V181M probably benign Het
Sprr2b G A 3: 92,317,636 C63Y unknown Het
Stpg2 A T 3: 139,232,223 Y181F probably damaging Het
Sult2a5 A T 7: 13,665,049 T194S probably benign Het
Tbx15 A T 3: 99,352,046 Q411L possibly damaging Het
Tln2 T A 9: 67,365,923 E427V probably damaging Het
Trpv4 A C 5: 114,622,795 V825G possibly damaging Het
Trrap A G 5: 144,817,786 I1968V probably benign Het
Ttn G A 2: 76,788,802 L16078F probably damaging Het
Unc45b T A 11: 82,915,062 F132I possibly damaging Het
Unc79 T A 12: 103,094,395 probably null Het
Vmn2r71 A T 7: 85,623,669 N564Y probably damaging Het
Zfp638 G T 6: 83,976,575 E1221* probably null Het
Zfp934 A T 13: 62,517,713 H371Q probably damaging Het
Zranb3 A G 1: 128,040,989 L63P probably damaging Het
Other mutations in Fyb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Fyb2 APN 4 105015716 missense probably damaging 1.00
IGL01155:Fyb2 APN 4 104999386 missense probably benign 0.00
IGL01632:Fyb2 APN 4 104995811 missense probably benign
IGL01746:Fyb2 APN 4 104945207 missense probably benign 0.01
IGL02381:Fyb2 APN 4 104948666 splice site probably benign
IGL02590:Fyb2 APN 4 104979053 missense probably damaging 1.00
IGL02885:Fyb2 APN 4 105003921 missense probably damaging 0.99
IGL03114:Fyb2 APN 4 104995778 missense probably damaging 0.97
IGL03189:Fyb2 APN 4 105015742 missense probably damaging 1.00
IGL03231:Fyb2 APN 4 104986263 nonsense probably null
R0076:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R0662:Fyb2 UTSW 4 104995698 missense possibly damaging 0.46
R0723:Fyb2 UTSW 4 105015866 missense probably benign 0.00
R1216:Fyb2 UTSW 4 104995706 missense possibly damaging 0.86
R1672:Fyb2 UTSW 4 104950862 missense probably benign 0.10
R1710:Fyb2 UTSW 4 105003916 missense probably damaging 1.00
R1900:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R1965:Fyb2 UTSW 4 104913649 missense probably benign 0.00
R2106:Fyb2 UTSW 4 104945572 missense probably benign 0.01
R5191:Fyb2 UTSW 4 104995797 missense possibly damaging 0.88
R5277:Fyb2 UTSW 4 105015679 missense probably damaging 1.00
R5502:Fyb2 UTSW 4 104945324 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105013321 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105015644 missense probably damaging 1.00
R6167:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R6169:Fyb2 UTSW 4 105000516 missense probably benign 0.16
R6371:Fyb2 UTSW 4 104995778 missense probably damaging 0.97
R6582:Fyb2 UTSW 4 104945542 missense probably benign 0.00
R6713:Fyb2 UTSW 4 104990235 missense probably benign 0.16
R6719:Fyb2 UTSW 4 105010459 missense probably benign 0.07
R7484:Fyb2 UTSW 4 105013302 missense probably benign 0.01
R7534:Fyb2 UTSW 4 104999348 nonsense probably null
R7590:Fyb2 UTSW 4 104945246 missense probably benign 0.01
R7699:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R7700:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R8041:Fyb2 UTSW 4 105000484 missense possibly damaging 0.82
R8755:Fyb2 UTSW 4 105003889 missense unknown
R8817:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R8873:Fyb2 UTSW 4 104999341 missense probably damaging 1.00
R8914:Fyb2 UTSW 4 105000503 missense probably benign 0.09
X0018:Fyb2 UTSW 4 104945210 missense probably benign 0.04
Z1176:Fyb2 UTSW 4 104913660 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGTCAAGAGGCCAGCAAGC -3'
(R):5'- CATTTCATGGGCAAGCTGC -3'

Sequencing Primer
(F):5'- GCTGGTCGGTTTTCTCCAACAAG -3'
(R):5'- CAGCCCCTTGAAAGAGCAGTTTG -3'
Posted On2016-07-06