Incidental Mutation 'R5204:Tmem30c'
ID398380
Institutional Source Beutler Lab
Gene Symbol Tmem30c
Ensembl Gene ENSMUSG00000022753
Gene Nametransmembrane protein 30C
Synonyms4933409A18Rik, 4933401B01Rik
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57266139-57292865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57270022 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 274 (N274S)
Ref Sequence ENSEMBL: ENSMUSP00000113896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023434] [ENSMUST00000119407] [ENSMUST00000120112]
Predicted Effect probably benign
Transcript: ENSMUST00000023434
AA Change: N274S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023434
Gene: ENSMUSG00000022753
AA Change: N274S

DomainStartEndE-ValueType
Pfam:CDC50 54 339 2.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119407
AA Change: N274S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112989
Gene: ENSMUSG00000022753
AA Change: N274S

DomainStartEndE-ValueType
Pfam:CDC50 53 340 2.6e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120112
AA Change: N274S

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113896
Gene: ENSMUSG00000022753
AA Change: N274S

DomainStartEndE-ValueType
Pfam:CDC50 53 283 9.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231600
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Abt1 G A 13: 23,422,668 R88C probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Ccdc57 A G 11: 120,886,062 V504A possibly damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clec4b1 T A 6: 123,071,535 *210R probably null Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klhl5 G T 5: 65,131,438 L14F possibly damaging Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Olfr609 C T 7: 103,492,540 V113M probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Rufy1 C T 11: 50,406,434 R397Q probably damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tor3a A G 1: 156,655,700 L384P probably damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Tmem30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tmem30c APN 16 57270074 missense probably damaging 1.00
IGL01115:Tmem30c APN 16 57276117 splice site probably benign
IGL01574:Tmem30c APN 16 57276742 missense possibly damaging 0.60
IGL02060:Tmem30c APN 16 57290898 missense probably benign
IGL03243:Tmem30c APN 16 57276150 missense probably benign 0.00
R0689:Tmem30c UTSW 16 57270173 missense probably damaging 1.00
R0699:Tmem30c UTSW 16 57276789 missense possibly damaging 0.69
R0763:Tmem30c UTSW 16 57270176 missense possibly damaging 0.90
R1353:Tmem30c UTSW 16 57277665 missense probably damaging 1.00
R1518:Tmem30c UTSW 16 57266492 missense probably damaging 0.99
R1707:Tmem30c UTSW 16 57266480 missense possibly damaging 0.79
R1843:Tmem30c UTSW 16 57276780 missense probably benign 0.02
R1865:Tmem30c UTSW 16 57269989 splice site probably benign
R2021:Tmem30c UTSW 16 57281362 missense probably damaging 1.00
R3419:Tmem30c UTSW 16 57277668 missense probably benign 0.25
R5007:Tmem30c UTSW 16 57266505 missense probably benign 0.00
R5626:Tmem30c UTSW 16 57276143 missense possibly damaging 0.74
R5863:Tmem30c UTSW 16 57270055 missense probably benign 0.02
R5869:Tmem30c UTSW 16 57266562 missense probably damaging 0.99
R6133:Tmem30c UTSW 16 57277737 missense probably damaging 1.00
R6359:Tmem30c UTSW 16 57276150 missense probably benign 0.00
R6813:Tmem30c UTSW 16 57281259 critical splice donor site probably null
R7268:Tmem30c UTSW 16 57266414 missense probably damaging 0.98
R7387:Tmem30c UTSW 16 57270023 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCCATCAGGAATCTGCAC -3'
(R):5'- ACTGGGCCAAACCTATCTATG -3'

Sequencing Primer
(F):5'- TCTTGGGAGGGTTCCAAAATAC -3'
(R):5'- TGGGCCAAACCTATCTATGAACTGG -3'
Posted On2016-07-06