Incidental Mutation 'R5236:Olfr459'
ID398385
Institutional Source Beutler Lab
Gene Symbol Olfr459
Ensembl Gene ENSMUSG00000045479
Gene Nameolfactory receptor 459
SynonymsGA_x6K02T2P3E9-5780974-5781915, MOR120-1
MMRRC Submission 044393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5236 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41768770-41775177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41772111 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 63 (G63C)
Ref Sequence ENSEMBL: ENSMUSP00000149928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050412] [ENSMUST00000214752] [ENSMUST00000214976]
Predicted Effect probably benign
Transcript: ENSMUST00000050412
AA Change: G63C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000061622
Gene: ENSMUSG00000045479
AA Change: G63C

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.7e-6 PFAM
Pfam:7tm_1 40 290 6.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203430
AA Change: G63C
SMART Domains Protein: ENSMUSP00000145036
Gene: ENSMUSG00000045479
AA Change: G63C

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.7e-6 PFAM
Pfam:7tm_1 40 290 6.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214752
AA Change: G63C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000214976
AA Change: G63C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,921 I180N possibly damaging Het
Actl9 T C 17: 33,434,099 S378P probably damaging Het
Agrn A T 4: 156,178,858 C263S possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Arid4b A G 13: 14,126,449 probably null Het
BC067074 A G 13: 113,366,220 Y153C probably benign Het
Bin2 T C 15: 100,662,534 N49D probably damaging Het
Ccdc39 T C 3: 33,830,102 T364A probably damaging Het
Cdcp1 A T 9: 123,185,193 V172D probably damaging Het
Cdh23 A G 10: 60,312,572 L2670P probably damaging Het
Cmtm4 G C 8: 104,357,746 F105L probably damaging Het
Ctsa G A 2: 164,838,911 V453M probably damaging Het
Cyp3a59 A G 5: 146,102,825 I303V probably benign Het
Cyp4f17 T C 17: 32,520,632 probably null Het
Dst C T 1: 34,164,417 R447C probably damaging Het
E2f7 C T 10: 110,767,209 P362S probably damaging Het
Fbxw9 A G 8: 85,066,345 T407A probably damaging Het
Fyb2 T C 4: 104,948,760 S346P probably benign Het
Git2 T A 5: 114,767,172 I75L probably damaging Het
H2-DMa T A 17: 34,137,939 L137Q probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrg T C 16: 22,961,513 probably benign Het
Htr7 A T 19: 36,056,769 I162N probably damaging Het
Itpripl1 A T 2: 127,141,850 F117L probably damaging Het
Kri1 T C 9: 21,275,941 Y392C probably damaging Het
Krt27 A C 11: 99,350,815 S87A possibly damaging Het
Lama1 T C 17: 67,804,492 V2246A probably benign Het
Lcn2 A T 2: 32,385,961 M119K probably benign Het
Lrp2 T C 2: 69,456,819 probably null Het
Lrp6 T C 6: 134,511,264 N290D probably damaging Het
Macf1 T C 4: 123,397,821 E2517G probably damaging Het
Melk G A 4: 44,344,959 C363Y probably benign Het
Mettl22 T A 16: 8,488,733 L351* probably null Het
Mms22l A G 4: 24,588,347 Q953R probably benign Het
Ndufaf7 T C 17: 78,939,631 S107P probably benign Het
Olfr446 A C 6: 42,927,781 R183S probably benign Het
Opa3 A G 7: 19,244,757 Y49C probably damaging Het
Pabpn1 T A 14: 54,894,942 M145K possibly damaging Het
Plce1 A C 19: 38,770,347 M1982L probably benign Het
Ppcdc A C 9: 57,414,654 I201S probably benign Het
Rag2 A T 2: 101,629,660 D105V probably damaging Het
Rnf130 C T 11: 50,095,978 T383I probably damaging Het
Sgip1 T G 4: 102,927,587 probably null Het
Slc23a2 T A 2: 132,075,584 I245F probably damaging Het
Slc4a9 A G 18: 36,530,847 Y308C probably benign Het
Slc7a15 C T 12: 8,539,005 V181M probably benign Het
Sprr2b G A 3: 92,317,636 C63Y unknown Het
Stpg2 A T 3: 139,232,223 Y181F probably damaging Het
Sult2a5 A T 7: 13,665,049 T194S probably benign Het
Tbx15 A T 3: 99,352,046 Q411L possibly damaging Het
Tln2 T A 9: 67,365,923 E427V probably damaging Het
Trpv4 A C 5: 114,622,795 V825G possibly damaging Het
Trrap A G 5: 144,817,786 I1968V probably benign Het
Ttn G A 2: 76,788,802 L16078F probably damaging Het
Unc45b T A 11: 82,915,062 F132I possibly damaging Het
Unc79 T A 12: 103,094,395 probably null Het
Vmn2r71 A T 7: 85,623,669 N564Y probably damaging Het
Zfp638 G T 6: 83,976,575 E1221* probably null Het
Zfp934 A T 13: 62,517,713 H371Q probably damaging Het
Zranb3 A G 1: 128,040,989 L63P probably damaging Het
Other mutations in Olfr459
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr459 APN 6 41772113 missense probably damaging 1.00
IGL01460:Olfr459 APN 6 41772282 missense probably benign 0.12
IGL02465:Olfr459 APN 6 41771556 missense probably damaging 1.00
R0352:Olfr459 UTSW 6 41772124 missense probably damaging 0.99
R0443:Olfr459 UTSW 6 41771895 missense possibly damaging 0.75
R0480:Olfr459 UTSW 6 41772264 missense probably benign 0.01
R1491:Olfr459 UTSW 6 41771522 missense possibly damaging 0.95
R1495:Olfr459 UTSW 6 41771903 missense probably damaging 1.00
R2103:Olfr459 UTSW 6 41772005 missense probably benign 0.36
R3688:Olfr459 UTSW 6 41772226 nonsense probably null
R3910:Olfr459 UTSW 6 41772149 missense probably benign 0.00
R4709:Olfr459 UTSW 6 41771508 missense probably benign 0.06
R4710:Olfr459 UTSW 6 41771508 missense probably benign 0.06
R4960:Olfr459 UTSW 6 41772069 missense probably damaging 0.97
R5162:Olfr459 UTSW 6 41771772 missense possibly damaging 0.80
R5441:Olfr459 UTSW 6 41771848 missense probably benign 0.00
R7171:Olfr459 UTSW 6 41772027 missense probably benign 0.09
R7400:Olfr459 UTSW 6 41771744 missense probably damaging 1.00
R8115:Olfr459 UTSW 6 41771538 missense probably benign 0.00
R8346:Olfr459 UTSW 6 41772123 missense probably damaging 1.00
R8363:Olfr459 UTSW 6 41771750 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCGGCTGTTCATGATGACG -3'
(R):5'- CTAGTGCAACTGAATTCTGCCTTC -3'

Sequencing Primer
(F):5'- GGCTGTTCATGATGACGCTATACC -3'
(R):5'- CTGGGTTTCCCTGGATCCCAAG -3'
Posted On2016-07-06