Incidental Mutation 'R5236:Or2a12'
ID 398387
Institutional Source Beutler Lab
Gene Symbol Or2a12
Ensembl Gene ENSMUSG00000073111
Gene Name olfactory receptor family 2 subfamily A member 12
Synonyms MOR261-12, GA_x6K02T2P3E9-4632269-4631343, Olfr446
MMRRC Submission 044393-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R5236 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42904167-42905093 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 42904715 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 183 (R183S)
Ref Sequence ENSEMBL: ENSMUSP00000150255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101461] [ENSMUST00000215369] [ENSMUST00000215686] [ENSMUST00000216199]
AlphaFold Q8VEV0
Predicted Effect probably benign
Transcript: ENSMUST00000101461
AA Change: R183S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099005
Gene: ENSMUSG00000073111
AA Change: R183S

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-62 PFAM
Pfam:7TM_GPCR_Srsx 32 282 1.7e-5 PFAM
Pfam:7tm_1 38 287 3.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215369
AA Change: R183S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215686
AA Change: R183S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216199
AA Change: R183S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,820,120 (GRCm39) I180N possibly damaging Het
Actl9 T C 17: 33,653,073 (GRCm39) S378P probably damaging Het
Agrn A T 4: 156,263,315 (GRCm39) C263S possibly damaging Het
Ahnak A G 19: 8,978,048 (GRCm39) I56V possibly damaging Het
Arid4b A G 13: 14,301,034 (GRCm39) probably null Het
Bin2 T C 15: 100,560,415 (GRCm39) N49D probably damaging Het
Ccdc39 T C 3: 33,884,251 (GRCm39) T364A probably damaging Het
Cdcp1 A T 9: 123,014,258 (GRCm39) V172D probably damaging Het
Cdh23 A G 10: 60,148,351 (GRCm39) L2670P probably damaging Het
Cmtm4 G C 8: 105,084,378 (GRCm39) F105L probably damaging Het
Cspg4b A G 13: 113,502,754 (GRCm39) Y153C probably benign Het
Ctsa G A 2: 164,680,831 (GRCm39) V453M probably damaging Het
Cyp3a59 A G 5: 146,039,635 (GRCm39) I303V probably benign Het
Cyp4f17 T C 17: 32,739,606 (GRCm39) probably null Het
Dst C T 1: 34,203,498 (GRCm39) R447C probably damaging Het
E2f7 C T 10: 110,603,070 (GRCm39) P362S probably damaging Het
Fbxw9 A G 8: 85,792,974 (GRCm39) T407A probably damaging Het
Fyb2 T C 4: 104,805,957 (GRCm39) S346P probably benign Het
Git2 T A 5: 114,905,233 (GRCm39) I75L probably damaging Het
H2-DMa T A 17: 34,356,913 (GRCm39) L137Q probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hrg T C 16: 22,780,263 (GRCm39) probably benign Het
Htr7 A T 19: 36,034,169 (GRCm39) I162N probably damaging Het
Itpripl1 A T 2: 126,983,770 (GRCm39) F117L probably damaging Het
Kri1 T C 9: 21,187,237 (GRCm39) Y392C probably damaging Het
Krt27 A C 11: 99,241,641 (GRCm39) S87A possibly damaging Het
Lama1 T C 17: 68,111,487 (GRCm39) V2246A probably benign Het
Lcn2 A T 2: 32,275,973 (GRCm39) M119K probably benign Het
Lrp2 T C 2: 69,287,163 (GRCm39) probably null Het
Lrp6 T C 6: 134,488,227 (GRCm39) N290D probably damaging Het
Macf1 T C 4: 123,291,614 (GRCm39) E2517G probably damaging Het
Melk G A 4: 44,344,959 (GRCm39) C363Y probably benign Het
Mettl22 T A 16: 8,306,597 (GRCm39) L351* probably null Het
Mms22l A G 4: 24,588,347 (GRCm39) Q953R probably benign Het
Ndufaf7 T C 17: 79,247,060 (GRCm39) S107P probably benign Het
Opa3 A G 7: 18,978,682 (GRCm39) Y49C probably damaging Het
Or9a2 C A 6: 41,749,045 (GRCm39) G63C probably benign Het
Pabpn1 T A 14: 55,132,399 (GRCm39) M145K possibly damaging Het
Plce1 A C 19: 38,758,791 (GRCm39) M1982L probably benign Het
Ppcdc A C 9: 57,321,937 (GRCm39) I201S probably benign Het
Rag2 A T 2: 101,460,005 (GRCm39) D105V probably damaging Het
Rnf130 C T 11: 49,986,805 (GRCm39) T383I probably damaging Het
Sgip1 T G 4: 102,784,784 (GRCm39) probably null Het
Slc23a2 T A 2: 131,917,504 (GRCm39) I245F probably damaging Het
Slc4a9 A G 18: 36,663,900 (GRCm39) Y308C probably benign Het
Slc7a15 C T 12: 8,589,005 (GRCm39) V181M probably benign Het
Sprr2b G A 3: 92,224,943 (GRCm39) C63Y unknown Het
Stpg2 A T 3: 138,937,984 (GRCm39) Y181F probably damaging Het
Sult2a5 A T 7: 13,398,974 (GRCm39) T194S probably benign Het
Tbx15 A T 3: 99,259,362 (GRCm39) Q411L possibly damaging Het
Tln2 T A 9: 67,273,205 (GRCm39) E427V probably damaging Het
Trpv4 A C 5: 114,760,856 (GRCm39) V825G possibly damaging Het
Trrap A G 5: 144,754,596 (GRCm39) I1968V probably benign Het
Ttn G A 2: 76,619,146 (GRCm39) L16078F probably damaging Het
Unc45b T A 11: 82,805,888 (GRCm39) F132I possibly damaging Het
Unc79 T A 12: 103,060,654 (GRCm39) probably null Het
Vmn2r71 A T 7: 85,272,877 (GRCm39) N564Y probably damaging Het
Zfp638 G T 6: 83,953,557 (GRCm39) E1221* probably null Het
Zfp934 A T 13: 62,665,527 (GRCm39) H371Q probably damaging Het
Zranb3 A G 1: 127,968,726 (GRCm39) L63P probably damaging Het
Other mutations in Or2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Or2a12 APN 6 42,904,830 (GRCm39) missense probably benign 0.24
IGL03164:Or2a12 APN 6 42,905,064 (GRCm39) nonsense probably null
PIT4519001:Or2a12 UTSW 6 42,904,578 (GRCm39) missense probably damaging 1.00
R1760:Or2a12 UTSW 6 42,904,431 (GRCm39) missense possibly damaging 0.90
R1883:Or2a12 UTSW 6 42,904,764 (GRCm39) missense probably damaging 0.99
R1884:Or2a12 UTSW 6 42,904,764 (GRCm39) missense probably damaging 0.99
R2180:Or2a12 UTSW 6 42,904,459 (GRCm39) missense probably benign 0.14
R3001:Or2a12 UTSW 6 42,904,888 (GRCm39) missense probably damaging 1.00
R3002:Or2a12 UTSW 6 42,904,888 (GRCm39) missense probably damaging 1.00
R4435:Or2a12 UTSW 6 42,905,023 (GRCm39) missense probably damaging 1.00
R4544:Or2a12 UTSW 6 42,904,348 (GRCm39) missense probably damaging 1.00
R4546:Or2a12 UTSW 6 42,904,348 (GRCm39) missense probably damaging 1.00
R5009:Or2a12 UTSW 6 42,904,367 (GRCm39) missense probably damaging 1.00
R5290:Or2a12 UTSW 6 42,904,972 (GRCm39) missense probably damaging 0.98
R5297:Or2a12 UTSW 6 42,904,371 (GRCm39) missense probably benign 0.17
R7371:Or2a12 UTSW 6 42,904,469 (GRCm39) nonsense probably null
R9308:Or2a12 UTSW 6 42,904,749 (GRCm39) missense probably benign 0.14
R9364:Or2a12 UTSW 6 42,904,534 (GRCm39) missense probably damaging 1.00
R9404:Or2a12 UTSW 6 42,904,750 (GRCm39) missense probably benign 0.14
X0065:Or2a12 UTSW 6 42,904,990 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCCCTAAGATGCTGACAAAT -3'
(R):5'- AACAGGTGGAGAAGGCCTTT -3'

Sequencing Primer
(F):5'- CCCCTAAGATGCTGACAAATATGGTG -3'
(R):5'- AGAAGGCCTTTCTGCGAC -3'
Posted On 2016-07-06