Incidental Mutation 'R5236:Cdcp1'
ID 398412
Institutional Source Beutler Lab
Gene Symbol Cdcp1
Ensembl Gene ENSMUSG00000035498
Gene Name CUB domain containing protein 1
Synonyms E030027H19Rik, 9030022E12Rik
MMRRC Submission 044393-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5236 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 122999889-123045103 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123014258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 172 (V172D)
Ref Sequence ENSEMBL: ENSMUSP00000042057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039229]
AlphaFold Q5U462
Predicted Effect probably damaging
Transcript: ENSMUST00000039229
AA Change: V172D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042057
Gene: ENSMUSG00000035498
AA Change: V172D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 56 267 1.33e-11 PROSPERO
internal_repeat_1 374 591 1.33e-11 PROSPERO
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140915
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,820,120 (GRCm39) I180N possibly damaging Het
Actl9 T C 17: 33,653,073 (GRCm39) S378P probably damaging Het
Agrn A T 4: 156,263,315 (GRCm39) C263S possibly damaging Het
Ahnak A G 19: 8,978,048 (GRCm39) I56V possibly damaging Het
Arid4b A G 13: 14,301,034 (GRCm39) probably null Het
Bin2 T C 15: 100,560,415 (GRCm39) N49D probably damaging Het
Ccdc39 T C 3: 33,884,251 (GRCm39) T364A probably damaging Het
Cdh23 A G 10: 60,148,351 (GRCm39) L2670P probably damaging Het
Cmtm4 G C 8: 105,084,378 (GRCm39) F105L probably damaging Het
Cspg4b A G 13: 113,502,754 (GRCm39) Y153C probably benign Het
Ctsa G A 2: 164,680,831 (GRCm39) V453M probably damaging Het
Cyp3a59 A G 5: 146,039,635 (GRCm39) I303V probably benign Het
Cyp4f17 T C 17: 32,739,606 (GRCm39) probably null Het
Dst C T 1: 34,203,498 (GRCm39) R447C probably damaging Het
E2f7 C T 10: 110,603,070 (GRCm39) P362S probably damaging Het
Fbxw9 A G 8: 85,792,974 (GRCm39) T407A probably damaging Het
Fyb2 T C 4: 104,805,957 (GRCm39) S346P probably benign Het
Git2 T A 5: 114,905,233 (GRCm39) I75L probably damaging Het
H2-DMa T A 17: 34,356,913 (GRCm39) L137Q probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hrg T C 16: 22,780,263 (GRCm39) probably benign Het
Htr7 A T 19: 36,034,169 (GRCm39) I162N probably damaging Het
Itpripl1 A T 2: 126,983,770 (GRCm39) F117L probably damaging Het
Kri1 T C 9: 21,187,237 (GRCm39) Y392C probably damaging Het
Krt27 A C 11: 99,241,641 (GRCm39) S87A possibly damaging Het
Lama1 T C 17: 68,111,487 (GRCm39) V2246A probably benign Het
Lcn2 A T 2: 32,275,973 (GRCm39) M119K probably benign Het
Lrp2 T C 2: 69,287,163 (GRCm39) probably null Het
Lrp6 T C 6: 134,488,227 (GRCm39) N290D probably damaging Het
Macf1 T C 4: 123,291,614 (GRCm39) E2517G probably damaging Het
Melk G A 4: 44,344,959 (GRCm39) C363Y probably benign Het
Mettl22 T A 16: 8,306,597 (GRCm39) L351* probably null Het
Mms22l A G 4: 24,588,347 (GRCm39) Q953R probably benign Het
Ndufaf7 T C 17: 79,247,060 (GRCm39) S107P probably benign Het
Opa3 A G 7: 18,978,682 (GRCm39) Y49C probably damaging Het
Or2a12 A C 6: 42,904,715 (GRCm39) R183S probably benign Het
Or9a2 C A 6: 41,749,045 (GRCm39) G63C probably benign Het
Pabpn1 T A 14: 55,132,399 (GRCm39) M145K possibly damaging Het
Plce1 A C 19: 38,758,791 (GRCm39) M1982L probably benign Het
Ppcdc A C 9: 57,321,937 (GRCm39) I201S probably benign Het
Rag2 A T 2: 101,460,005 (GRCm39) D105V probably damaging Het
Rnf130 C T 11: 49,986,805 (GRCm39) T383I probably damaging Het
Sgip1 T G 4: 102,784,784 (GRCm39) probably null Het
Slc23a2 T A 2: 131,917,504 (GRCm39) I245F probably damaging Het
Slc4a9 A G 18: 36,663,900 (GRCm39) Y308C probably benign Het
Slc7a15 C T 12: 8,589,005 (GRCm39) V181M probably benign Het
Sprr2b G A 3: 92,224,943 (GRCm39) C63Y unknown Het
Stpg2 A T 3: 138,937,984 (GRCm39) Y181F probably damaging Het
Sult2a5 A T 7: 13,398,974 (GRCm39) T194S probably benign Het
Tbx15 A T 3: 99,259,362 (GRCm39) Q411L possibly damaging Het
Tln2 T A 9: 67,273,205 (GRCm39) E427V probably damaging Het
Trpv4 A C 5: 114,760,856 (GRCm39) V825G possibly damaging Het
Trrap A G 5: 144,754,596 (GRCm39) I1968V probably benign Het
Ttn G A 2: 76,619,146 (GRCm39) L16078F probably damaging Het
Unc45b T A 11: 82,805,888 (GRCm39) F132I possibly damaging Het
Unc79 T A 12: 103,060,654 (GRCm39) probably null Het
Vmn2r71 A T 7: 85,272,877 (GRCm39) N564Y probably damaging Het
Zfp638 G T 6: 83,953,557 (GRCm39) E1221* probably null Het
Zfp934 A T 13: 62,665,527 (GRCm39) H371Q probably damaging Het
Zranb3 A G 1: 127,968,726 (GRCm39) L63P probably damaging Het
Other mutations in Cdcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cdcp1 APN 9 123,009,066 (GRCm39) nonsense probably null
IGL01883:Cdcp1 APN 9 123,012,663 (GRCm39) missense probably benign 0.18
IGL02029:Cdcp1 APN 9 123,012,899 (GRCm39) splice site probably benign
IGL02115:Cdcp1 APN 9 123,014,462 (GRCm39) missense probably damaging 1.00
IGL02516:Cdcp1 APN 9 123,002,702 (GRCm39) missense possibly damaging 0.86
IGL02709:Cdcp1 APN 9 123,002,879 (GRCm39) missense probably damaging 1.00
IGL03263:Cdcp1 APN 9 123,009,152 (GRCm39) missense probably benign 0.12
IGL03406:Cdcp1 APN 9 123,014,378 (GRCm39) missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123,009,237 (GRCm39) missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123,009,237 (GRCm39) missense probably benign 0.00
R0939:Cdcp1 UTSW 9 123,012,755 (GRCm39) missense probably damaging 1.00
R1411:Cdcp1 UTSW 9 123,019,177 (GRCm39) missense probably damaging 0.99
R1460:Cdcp1 UTSW 9 123,009,092 (GRCm39) missense possibly damaging 0.69
R1538:Cdcp1 UTSW 9 123,002,653 (GRCm39) missense probably damaging 1.00
R1660:Cdcp1 UTSW 9 123,014,427 (GRCm39) missense probably benign 0.09
R1673:Cdcp1 UTSW 9 123,007,086 (GRCm39) nonsense probably null
R1794:Cdcp1 UTSW 9 123,044,896 (GRCm39) missense probably benign
R1794:Cdcp1 UTSW 9 123,019,159 (GRCm39) missense probably benign 0.37
R2472:Cdcp1 UTSW 9 123,014,172 (GRCm39) missense probably benign 0.07
R3961:Cdcp1 UTSW 9 123,011,446 (GRCm39) missense possibly damaging 0.73
R3962:Cdcp1 UTSW 9 123,011,446 (GRCm39) missense possibly damaging 0.73
R4288:Cdcp1 UTSW 9 123,012,693 (GRCm39) missense probably damaging 0.99
R4888:Cdcp1 UTSW 9 123,011,194 (GRCm39) intron probably benign
R4953:Cdcp1 UTSW 9 123,009,088 (GRCm39) missense probably benign 0.00
R5546:Cdcp1 UTSW 9 123,007,094 (GRCm39) missense probably damaging 1.00
R5848:Cdcp1 UTSW 9 123,012,770 (GRCm39) missense possibly damaging 0.87
R5903:Cdcp1 UTSW 9 123,002,837 (GRCm39) nonsense probably null
R6052:Cdcp1 UTSW 9 123,014,396 (GRCm39) missense probably benign 0.04
R6344:Cdcp1 UTSW 9 123,011,447 (GRCm39) missense possibly damaging 0.69
R6904:Cdcp1 UTSW 9 123,002,980 (GRCm39) missense probably benign
R7038:Cdcp1 UTSW 9 123,002,662 (GRCm39) missense probably damaging 1.00
R7092:Cdcp1 UTSW 9 123,012,678 (GRCm39) missense probably benign 0.20
R7262:Cdcp1 UTSW 9 123,002,680 (GRCm39) missense probably damaging 1.00
R7275:Cdcp1 UTSW 9 123,014,119 (GRCm39) missense possibly damaging 0.79
R7294:Cdcp1 UTSW 9 123,006,986 (GRCm39) missense probably benign 0.01
R7373:Cdcp1 UTSW 9 123,006,965 (GRCm39) missense probably damaging 1.00
R7394:Cdcp1 UTSW 9 123,002,878 (GRCm39) missense probably damaging 1.00
R7527:Cdcp1 UTSW 9 123,014,172 (GRCm39) missense probably benign 0.26
R7674:Cdcp1 UTSW 9 123,045,071 (GRCm39) start gained probably benign
R7680:Cdcp1 UTSW 9 123,012,584 (GRCm39) missense probably damaging 1.00
R8079:Cdcp1 UTSW 9 123,002,855 (GRCm39) missense probably damaging 1.00
R8355:Cdcp1 UTSW 9 123,002,888 (GRCm39) missense probably benign 0.16
R8749:Cdcp1 UTSW 9 123,019,027 (GRCm39) missense probably benign 0.02
R8770:Cdcp1 UTSW 9 123,006,926 (GRCm39) missense possibly damaging 0.73
R8964:Cdcp1 UTSW 9 123,012,561 (GRCm39) nonsense probably null
R9241:Cdcp1 UTSW 9 123,014,301 (GRCm39) missense probably damaging 1.00
R9520:Cdcp1 UTSW 9 123,012,736 (GRCm39) missense possibly damaging 0.87
X0028:Cdcp1 UTSW 9 123,014,249 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCTGGAACGTTCTGCATAC -3'
(R):5'- GGGAGGTTCATCTTCAGCCATC -3'

Sequencing Primer
(F):5'- ATCCATCTGATCACACAGTGGGG -3'
(R):5'- TTCATCTTCAGCCATCCACATCAGAG -3'
Posted On 2016-07-06