Mutagenetix > Incidental Mutation

Incidental Mutation 'R5236:Unc45b'

398419

Institutional Source

Beutler Lab

Gene Symbol

Unc45b

Ensembl Gene

ENSMUSG00000018845

Gene Name

unc-45 myosin chaperone B

Synonyms

Cmya4, D230041A13Rik, UNC45

MMRRC Submission

044393-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5236 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82910550-82943403 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82915062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 132 (F132I)

Ref Sequence

ENSEMBL: ENSMUSP00000129405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000164945]

AlphaFold

Q8CGY6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018989
AA Change: F132I

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: F132I

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	541	582	7e-7	BLAST
Blast:ARM	661	701	2e-14	BLAST
Blast:ARM	704	746	5e-11	BLAST
Blast:ARM	747	788	1e-20	BLAST
Blast:ARM	789	820	1e-11	BLAST
low complexity region	821	832	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108160
AA Change: F132I

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: F132I

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	271	489	2.2e-52	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164945
AA Change: F132I

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: F132I

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9630041A04Rik	T	A	9: 101,942,921	I180N	possibly damaging	Het
Actl9	T	C	17: 33,434,099	S378P	probably damaging	Het
Agrn	A	T	4: 156,178,858	C263S	possibly damaging	Het
Ahnak	A	G	19: 9,000,684	I56V	possibly damaging	Het
Arid4b	A	G	13: 14,126,449		probably null	Het
BC067074	A	G	13: 113,366,220	Y153C	probably benign	Het
Bin2	T	C	15: 100,662,534	N49D	probably damaging	Het
Ccdc39	T	C	3: 33,830,102	T364A	probably damaging	Het
Cdcp1	A	T	9: 123,185,193	V172D	probably damaging	Het
Cdh23	A	G	10: 60,312,572	L2670P	probably damaging	Het
Cmtm4	G	C	8: 104,357,746	F105L	probably damaging	Het
Ctsa	G	A	2: 164,838,911	V453M	probably damaging	Het
Cyp3a59	A	G	5: 146,102,825	I303V	probably benign	Het
Cyp4f17	T	C	17: 32,520,632		probably null	Het
Dst	C	T	1: 34,164,417	R447C	probably damaging	Het
E2f7	C	T	10: 110,767,209	P362S	probably damaging	Het
Fbxw9	A	G	8: 85,066,345	T407A	probably damaging	Het
Fyb2	T	C	4: 104,948,760	S346P	probably benign	Het
Git2	T	A	5: 114,767,172	I75L	probably damaging	Het
H2-DMa	T	A	17: 34,137,939	L137Q	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrg	T	C	16: 22,961,513		probably benign	Het
Htr7	A	T	19: 36,056,769	I162N	probably damaging	Het
Itpripl1	A	T	2: 127,141,850	F117L	probably damaging	Het
Kri1	T	C	9: 21,275,941	Y392C	probably damaging	Het
Krt27	A	C	11: 99,350,815	S87A	possibly damaging	Het
Lama1	T	C	17: 67,804,492	V2246A	probably benign	Het
Lcn2	A	T	2: 32,385,961	M119K	probably benign	Het
Lrp2	T	C	2: 69,456,819		probably null	Het
Lrp6	T	C	6: 134,511,264	N290D	probably damaging	Het
Macf1	T	C	4: 123,397,821	E2517G	probably damaging	Het
Melk	G	A	4: 44,344,959	C363Y	probably benign	Het
Mettl22	T	A	16: 8,488,733	L351*	probably null	Het
Mms22l	A	G	4: 24,588,347	Q953R	probably benign	Het
Ndufaf7	T	C	17: 78,939,631	S107P	probably benign	Het
Olfr446	A	C	6: 42,927,781	R183S	probably benign	Het
Olfr459	C	A	6: 41,772,111	G63C	probably benign	Het
Opa3	A	G	7: 19,244,757	Y49C	probably damaging	Het
Pabpn1	T	A	14: 54,894,942	M145K	possibly damaging	Het
Plce1	A	C	19: 38,770,347	M1982L	probably benign	Het
Ppcdc	A	C	9: 57,414,654	I201S	probably benign	Het
Rag2	A	T	2: 101,629,660	D105V	probably damaging	Het
Rnf130	C	T	11: 50,095,978	T383I	probably damaging	Het
Sgip1	T	G	4: 102,927,587		probably null	Het
Slc23a2	T	A	2: 132,075,584	I245F	probably damaging	Het
Slc4a9	A	G	18: 36,530,847	Y308C	probably benign	Het
Slc7a15	C	T	12: 8,539,005	V181M	probably benign	Het
Sprr2b	G	A	3: 92,317,636	C63Y	unknown	Het
Stpg2	A	T	3: 139,232,223	Y181F	probably damaging	Het
Sult2a5	A	T	7: 13,665,049	T194S	probably benign	Het
Tbx15	A	T	3: 99,352,046	Q411L	possibly damaging	Het
Tln2	T	A	9: 67,365,923	E427V	probably damaging	Het
Trpv4	A	C	5: 114,622,795	V825G	possibly damaging	Het
Trrap	A	G	5: 144,817,786	I1968V	probably benign	Het
Ttn	G	A	2: 76,788,802	L16078F	probably damaging	Het
Unc79	T	A	12: 103,094,395		probably null	Het
Vmn2r71	A	T	7: 85,623,669	N564Y	probably damaging	Het
Zfp638	G	T	6: 83,976,575	E1221*	probably null	Het
Zfp934	A	T	13: 62,517,713	H371Q	probably damaging	Het
Zranb3	A	G	1: 128,040,989	L63P	probably damaging	Het

Other mutations in Unc45b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01320:Unc45b	APN	11	82912393	critical splice acceptor site	probably null
IGL01983:Unc45b	APN	11	82936861	missense	probably benign
IGL02083:Unc45b	APN	11	82922919	missense	probably damaging	0.96
IGL02159:Unc45b	APN	11	82940181	splice site	probably benign
IGL02160:Unc45b	APN	11	82940181	splice site	probably benign
IGL02165:Unc45b	APN	11	82940181	splice site	probably benign
IGL02166:Unc45b	APN	11	82940181	splice site	probably benign
IGL02986:Unc45b	APN	11	82917179	missense	probably damaging	0.98
fife	UTSW	11	82936852	missense	probably benign	0.00
R0195:Unc45b	UTSW	11	82937828	missense	probably damaging	1.00
R0197:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R0218:Unc45b	UTSW	11	82911860	splice site	probably benign
R0436:Unc45b	UTSW	11	82929567	splice site	probably benign
R0569:Unc45b	UTSW	11	82936812	splice site	probably benign
R0701:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R0883:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R1146:Unc45b	UTSW	11	82922907	missense	probably damaging	0.99
R1146:Unc45b	UTSW	11	82922907	missense	probably damaging	0.99
R1378:Unc45b	UTSW	11	82936852	missense	probably benign	0.00
R1446:Unc45b	UTSW	11	82928670	missense	probably damaging	1.00
R1532:Unc45b	UTSW	11	82936874	missense	probably benign	0.12
R1559:Unc45b	UTSW	11	82917846	missense	possibly damaging	0.66
R1582:Unc45b	UTSW	11	82925945	missense	probably benign	0.30
R1628:Unc45b	UTSW	11	82929380	splice site	probably null
R1666:Unc45b	UTSW	11	82917739	missense	probably benign	0.31
R1677:Unc45b	UTSW	11	82911705	splice site	probably null
R1759:Unc45b	UTSW	11	82929499	missense	probably benign	0.33
R1909:Unc45b	UTSW	11	82926087	missense	probably damaging	1.00
R2067:Unc45b	UTSW	11	82911689	missense	probably benign	0.01
R2111:Unc45b	UTSW	11	82911689	missense	probably benign	0.01
R2145:Unc45b	UTSW	11	82917754	missense	probably benign	0.30
R2258:Unc45b	UTSW	11	82917799	missense	probably benign	0.01
R2259:Unc45b	UTSW	11	82917799	missense	probably benign	0.01
R2497:Unc45b	UTSW	11	82936443	missense	probably damaging	1.00
R2507:Unc45b	UTSW	11	82940137	splice site	probably null
R4352:Unc45b	UTSW	11	82913209	missense	probably damaging	0.99
R4569:Unc45b	UTSW	11	82936489	critical splice donor site	probably null
R4624:Unc45b	UTSW	11	82926009	missense	probably benign	0.30
R5512:Unc45b	UTSW	11	82915072	missense	possibly damaging	0.47
R5688:Unc45b	UTSW	11	82922817	missense	possibly damaging	0.88
R6029:Unc45b	UTSW	11	82913327	missense	probably damaging	1.00
R6616:Unc45b	UTSW	11	82911819	missense	probably damaging	1.00
R6857:Unc45b	UTSW	11	82913212	missense	probably benign	0.00
R6876:Unc45b	UTSW	11	82922912	missense	probably benign	0.00
R7197:Unc45b	UTSW	11	82940187	critical splice acceptor site	probably null
R7368:Unc45b	UTSW	11	82942495	missense	probably benign	0.01
R7531:Unc45b	UTSW	11	82929012	missense	probably damaging	1.00
R7743:Unc45b	UTSW	11	82922900	missense	probably damaging	1.00
R8198:Unc45b	UTSW	11	82925988	frame shift	probably null
R8214:Unc45b	UTSW	11	82933888	missense	possibly damaging	0.50
R8235:Unc45b	UTSW	11	82919855	missense	probably benign	0.01
R8916:Unc45b	UTSW	11	82913212	missense	probably benign	0.00
R9004:Unc45b	UTSW	11	82928689	missense	probably damaging	1.00
R9521:Unc45b	UTSW	11	82917760	missense	probably benign	0.09
R9687:Unc45b	UTSW	11	82919736	missense	probably damaging	1.00
R9757:Unc45b	UTSW	11	82919732	missense	probably damaging	0.99
R9784:Unc45b	UTSW	11	82926160	missense	probably damaging	1.00
T0970:Unc45b	UTSW	11	82922888	missense	probably benign	0.00
Z1176:Unc45b	UTSW	11	82928654	critical splice acceptor site	probably null
Z1176:Unc45b	UTSW	11	82942715	missense	probably damaging	1.00
Z1177:Unc45b	UTSW	11	82942553	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTAGGTCTCAGGGCTTG -3'
(R):5'- GGAGCCAAGGTTTCTCCATAGC -3'

Sequencing Primer
(F):5'- TGCTCTGCAAAAGCCTTTG -3'
(R):5'- CAAGGTTTCTCCATAGCCGTGG -3'

Posted On

2016-07-06