Incidental Mutation 'R5236:Hrg'
ID398439
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Namehistidine-rich glycoprotein
SynonymsD18020, D16JH2
MMRRC Submission 044393-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R5236 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22951072-22961656 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 22961513 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
Predicted Effect unknown
Transcript: ENSMUST00000023590
AA Change: S514P
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: S514P

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232422
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,921 I180N possibly damaging Het
Actl9 T C 17: 33,434,099 S378P probably damaging Het
Agrn A T 4: 156,178,858 C263S possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Arid4b A G 13: 14,126,449 probably null Het
BC067074 A G 13: 113,366,220 Y153C probably benign Het
Bin2 T C 15: 100,662,534 N49D probably damaging Het
Ccdc39 T C 3: 33,830,102 T364A probably damaging Het
Cdcp1 A T 9: 123,185,193 V172D probably damaging Het
Cdh23 A G 10: 60,312,572 L2670P probably damaging Het
Cmtm4 G C 8: 104,357,746 F105L probably damaging Het
Ctsa G A 2: 164,838,911 V453M probably damaging Het
Cyp3a59 A G 5: 146,102,825 I303V probably benign Het
Cyp4f17 T C 17: 32,520,632 probably null Het
Dst C T 1: 34,164,417 R447C probably damaging Het
E2f7 C T 10: 110,767,209 P362S probably damaging Het
Fbxw9 A G 8: 85,066,345 T407A probably damaging Het
Fyb2 T C 4: 104,948,760 S346P probably benign Het
Git2 T A 5: 114,767,172 I75L probably damaging Het
H2-DMa T A 17: 34,137,939 L137Q probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr7 A T 19: 36,056,769 I162N probably damaging Het
Itpripl1 A T 2: 127,141,850 F117L probably damaging Het
Kri1 T C 9: 21,275,941 Y392C probably damaging Het
Krt27 A C 11: 99,350,815 S87A possibly damaging Het
Lama1 T C 17: 67,804,492 V2246A probably benign Het
Lcn2 A T 2: 32,385,961 M119K probably benign Het
Lrp2 T C 2: 69,456,819 probably null Het
Lrp6 T C 6: 134,511,264 N290D probably damaging Het
Macf1 T C 4: 123,397,821 E2517G probably damaging Het
Melk G A 4: 44,344,959 C363Y probably benign Het
Mettl22 T A 16: 8,488,733 L351* probably null Het
Mms22l A G 4: 24,588,347 Q953R probably benign Het
Ndufaf7 T C 17: 78,939,631 S107P probably benign Het
Olfr446 A C 6: 42,927,781 R183S probably benign Het
Olfr459 C A 6: 41,772,111 G63C probably benign Het
Opa3 A G 7: 19,244,757 Y49C probably damaging Het
Pabpn1 T A 14: 54,894,942 M145K possibly damaging Het
Plce1 A C 19: 38,770,347 M1982L probably benign Het
Ppcdc A C 9: 57,414,654 I201S probably benign Het
Rag2 A T 2: 101,629,660 D105V probably damaging Het
Rnf130 C T 11: 50,095,978 T383I probably damaging Het
Sgip1 T G 4: 102,927,587 probably null Het
Slc23a2 T A 2: 132,075,584 I245F probably damaging Het
Slc4a9 A G 18: 36,530,847 Y308C probably benign Het
Slc7a15 C T 12: 8,539,005 V181M probably benign Het
Sprr2b G A 3: 92,317,636 C63Y unknown Het
Stpg2 A T 3: 139,232,223 Y181F probably damaging Het
Sult2a5 A T 7: 13,665,049 T194S probably benign Het
Tbx15 A T 3: 99,352,046 Q411L possibly damaging Het
Tln2 T A 9: 67,365,923 E427V probably damaging Het
Trpv4 A C 5: 114,622,795 V825G possibly damaging Het
Trrap A G 5: 144,817,786 I1968V probably benign Het
Ttn G A 2: 76,788,802 L16078F probably damaging Het
Unc45b T A 11: 82,915,062 F132I possibly damaging Het
Unc79 T A 12: 103,094,395 probably null Het
Vmn2r71 A T 7: 85,623,669 N564Y probably damaging Het
Zfp638 G T 6: 83,976,575 E1221* probably null Het
Zfp934 A T 13: 62,517,713 H371Q probably damaging Het
Zranb3 A G 1: 128,040,989 L63P probably damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22959159 critical splice acceptor site probably null
IGL02795:Hrg APN 16 22957553 unclassified probably benign
R0042:Hrg UTSW 16 22961136 unclassified probably benign
R0184:Hrg UTSW 16 22953771 critical splice donor site probably null
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1733:Hrg UTSW 16 22951247 missense probably damaging 1.00
R1828:Hrg UTSW 16 22956103 missense probably damaging 1.00
R1919:Hrg UTSW 16 22954457 missense probably damaging 1.00
R2104:Hrg UTSW 16 22956199 missense probably benign 0.09
R2281:Hrg UTSW 16 22961309 unclassified probably benign
R2447:Hrg UTSW 16 22961148 unclassified probably benign
R3962:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R3963:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R4571:Hrg UTSW 16 22961222 unclassified probably benign
R4903:Hrg UTSW 16 22961151 unclassified probably benign
R4904:Hrg UTSW 16 22951250 missense probably benign 0.03
R6020:Hrg UTSW 16 22954518 missense probably damaging 1.00
R6054:Hrg UTSW 16 22953662 missense probably benign 0.05
R6207:Hrg UTSW 16 22954538 critical splice donor site probably null
R6374:Hrg UTSW 16 22960992 missense probably damaging 0.98
R7516:Hrg UTSW 16 22961298 missense unknown
R7606:Hrg UTSW 16 22951123 start codon destroyed probably null 0.01
R8190:Hrg UTSW 16 22961043 missense unknown
R8349:Hrg UTSW 16 22961536 missense unknown
R8449:Hrg UTSW 16 22961536 missense unknown
Z1177:Hrg UTSW 16 22953712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCAGTATCATCGGGGC -3'
(R):5'- CCCATACTTCCCTATGTATGAAACC -3'

Sequencing Primer
(F):5'- TATCATCGGGGCTATGGTCCAC -3'
(R):5'- CCCTACCAAGGAATCAGG -3'
Posted On2016-07-06