Incidental Mutation 'R5236:Hrg'
ID 398439
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Name histidine-rich glycoprotein
Synonyms D18020, D16JH2
MMRRC Submission 044393-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R5236 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 22769822-22780406 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 22780263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023590
AA Change: S514P
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: S514P

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232422
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,820,120 (GRCm39) I180N possibly damaging Het
Actl9 T C 17: 33,653,073 (GRCm39) S378P probably damaging Het
Agrn A T 4: 156,263,315 (GRCm39) C263S possibly damaging Het
Ahnak A G 19: 8,978,048 (GRCm39) I56V possibly damaging Het
Arid4b A G 13: 14,301,034 (GRCm39) probably null Het
Bin2 T C 15: 100,560,415 (GRCm39) N49D probably damaging Het
Ccdc39 T C 3: 33,884,251 (GRCm39) T364A probably damaging Het
Cdcp1 A T 9: 123,014,258 (GRCm39) V172D probably damaging Het
Cdh23 A G 10: 60,148,351 (GRCm39) L2670P probably damaging Het
Cmtm4 G C 8: 105,084,378 (GRCm39) F105L probably damaging Het
Cspg4b A G 13: 113,502,754 (GRCm39) Y153C probably benign Het
Ctsa G A 2: 164,680,831 (GRCm39) V453M probably damaging Het
Cyp3a59 A G 5: 146,039,635 (GRCm39) I303V probably benign Het
Cyp4f17 T C 17: 32,739,606 (GRCm39) probably null Het
Dst C T 1: 34,203,498 (GRCm39) R447C probably damaging Het
E2f7 C T 10: 110,603,070 (GRCm39) P362S probably damaging Het
Fbxw9 A G 8: 85,792,974 (GRCm39) T407A probably damaging Het
Fyb2 T C 4: 104,805,957 (GRCm39) S346P probably benign Het
Git2 T A 5: 114,905,233 (GRCm39) I75L probably damaging Het
H2-DMa T A 17: 34,356,913 (GRCm39) L137Q probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Htr7 A T 19: 36,034,169 (GRCm39) I162N probably damaging Het
Itpripl1 A T 2: 126,983,770 (GRCm39) F117L probably damaging Het
Kri1 T C 9: 21,187,237 (GRCm39) Y392C probably damaging Het
Krt27 A C 11: 99,241,641 (GRCm39) S87A possibly damaging Het
Lama1 T C 17: 68,111,487 (GRCm39) V2246A probably benign Het
Lcn2 A T 2: 32,275,973 (GRCm39) M119K probably benign Het
Lrp2 T C 2: 69,287,163 (GRCm39) probably null Het
Lrp6 T C 6: 134,488,227 (GRCm39) N290D probably damaging Het
Macf1 T C 4: 123,291,614 (GRCm39) E2517G probably damaging Het
Melk G A 4: 44,344,959 (GRCm39) C363Y probably benign Het
Mettl22 T A 16: 8,306,597 (GRCm39) L351* probably null Het
Mms22l A G 4: 24,588,347 (GRCm39) Q953R probably benign Het
Ndufaf7 T C 17: 79,247,060 (GRCm39) S107P probably benign Het
Opa3 A G 7: 18,978,682 (GRCm39) Y49C probably damaging Het
Or2a12 A C 6: 42,904,715 (GRCm39) R183S probably benign Het
Or9a2 C A 6: 41,749,045 (GRCm39) G63C probably benign Het
Pabpn1 T A 14: 55,132,399 (GRCm39) M145K possibly damaging Het
Plce1 A C 19: 38,758,791 (GRCm39) M1982L probably benign Het
Ppcdc A C 9: 57,321,937 (GRCm39) I201S probably benign Het
Rag2 A T 2: 101,460,005 (GRCm39) D105V probably damaging Het
Rnf130 C T 11: 49,986,805 (GRCm39) T383I probably damaging Het
Sgip1 T G 4: 102,784,784 (GRCm39) probably null Het
Slc23a2 T A 2: 131,917,504 (GRCm39) I245F probably damaging Het
Slc4a9 A G 18: 36,663,900 (GRCm39) Y308C probably benign Het
Slc7a15 C T 12: 8,589,005 (GRCm39) V181M probably benign Het
Sprr2b G A 3: 92,224,943 (GRCm39) C63Y unknown Het
Stpg2 A T 3: 138,937,984 (GRCm39) Y181F probably damaging Het
Sult2a5 A T 7: 13,398,974 (GRCm39) T194S probably benign Het
Tbx15 A T 3: 99,259,362 (GRCm39) Q411L possibly damaging Het
Tln2 T A 9: 67,273,205 (GRCm39) E427V probably damaging Het
Trpv4 A C 5: 114,760,856 (GRCm39) V825G possibly damaging Het
Trrap A G 5: 144,754,596 (GRCm39) I1968V probably benign Het
Ttn G A 2: 76,619,146 (GRCm39) L16078F probably damaging Het
Unc45b T A 11: 82,805,888 (GRCm39) F132I possibly damaging Het
Unc79 T A 12: 103,060,654 (GRCm39) probably null Het
Vmn2r71 A T 7: 85,272,877 (GRCm39) N564Y probably damaging Het
Zfp638 G T 6: 83,953,557 (GRCm39) E1221* probably null Het
Zfp934 A T 13: 62,665,527 (GRCm39) H371Q probably damaging Het
Zranb3 A G 1: 127,968,726 (GRCm39) L63P probably damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22,777,909 (GRCm39) critical splice acceptor site probably null
IGL02795:Hrg APN 16 22,776,303 (GRCm39) unclassified probably benign
R0042:Hrg UTSW 16 22,779,886 (GRCm39) unclassified probably benign
R0184:Hrg UTSW 16 22,772,521 (GRCm39) critical splice donor site probably null
R1147:Hrg UTSW 16 22,779,754 (GRCm39) missense probably damaging 0.99
R1147:Hrg UTSW 16 22,779,754 (GRCm39) missense probably damaging 0.99
R1733:Hrg UTSW 16 22,769,997 (GRCm39) missense probably damaging 1.00
R1828:Hrg UTSW 16 22,774,853 (GRCm39) missense probably damaging 1.00
R1919:Hrg UTSW 16 22,773,207 (GRCm39) missense probably damaging 1.00
R2104:Hrg UTSW 16 22,774,949 (GRCm39) missense probably benign 0.09
R2281:Hrg UTSW 16 22,780,059 (GRCm39) unclassified probably benign
R2447:Hrg UTSW 16 22,779,898 (GRCm39) unclassified probably benign
R3962:Hrg UTSW 16 22,774,825 (GRCm39) missense possibly damaging 0.85
R3963:Hrg UTSW 16 22,774,825 (GRCm39) missense possibly damaging 0.85
R4571:Hrg UTSW 16 22,779,972 (GRCm39) unclassified probably benign
R4903:Hrg UTSW 16 22,779,901 (GRCm39) unclassified probably benign
R4904:Hrg UTSW 16 22,770,000 (GRCm39) missense probably benign 0.03
R6020:Hrg UTSW 16 22,773,268 (GRCm39) missense probably damaging 1.00
R6054:Hrg UTSW 16 22,772,412 (GRCm39) missense probably benign 0.05
R6207:Hrg UTSW 16 22,773,288 (GRCm39) critical splice donor site probably null
R6374:Hrg UTSW 16 22,779,742 (GRCm39) missense probably damaging 0.98
R7516:Hrg UTSW 16 22,780,048 (GRCm39) missense unknown
R7606:Hrg UTSW 16 22,769,873 (GRCm39) start codon destroyed probably null 0.01
R8190:Hrg UTSW 16 22,779,793 (GRCm39) missense unknown
R8349:Hrg UTSW 16 22,780,286 (GRCm39) missense unknown
R8449:Hrg UTSW 16 22,780,286 (GRCm39) missense unknown
R8973:Hrg UTSW 16 22,777,968 (GRCm39) missense probably benign 0.22
R8998:Hrg UTSW 16 22,772,455 (GRCm39) missense probably damaging 0.99
R9334:Hrg UTSW 16 22,780,061 (GRCm39) missense unknown
Z1177:Hrg UTSW 16 22,772,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCAGTATCATCGGGGC -3'
(R):5'- CCCATACTTCCCTATGTATGAAACC -3'

Sequencing Primer
(F):5'- TATCATCGGGGCTATGGTCCAC -3'
(R):5'- CCCTACCAAGGAATCAGG -3'
Posted On 2016-07-06