Incidental Mutation 'R0454:Slc6a17'
ID 39845
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 038654-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R0454 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107384183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 387 (L387P)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect probably benign
Transcript: ENSMUST00000029499
AA Change: L387P

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: L387P

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168211
AA Change: L346P

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: L346P

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169449
AA Change: L387P

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: L387P

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447F04Rik T C X: 65,347,274 (GRCm39) E91G unknown Het
Acot1 A G 12: 84,064,113 (GRCm39) Q407R probably benign Het
Adcy10 T A 1: 165,398,297 (GRCm39) Y1465N probably damaging Het
Ahsa2 T A 11: 23,440,702 (GRCm39) I249F probably damaging Het
Arhgap10 T C 8: 77,977,594 (GRCm39) N721S probably damaging Het
Arrdc4 T G 7: 68,391,619 (GRCm39) E216A probably damaging Het
Axin1 T C 17: 26,392,637 (GRCm39) V306A probably benign Het
Cct3 T C 3: 88,210,173 (GRCm39) probably null Het
Cfap58 G A 19: 47,963,119 (GRCm39) probably null Het
Chd9 T C 8: 91,699,859 (GRCm39) S49P possibly damaging Het
Clcn2 C A 16: 20,529,178 (GRCm39) probably null Het
Col26a1 T C 5: 136,783,047 (GRCm39) N286D probably benign Het
Cpt1b T A 15: 89,308,596 (GRCm39) I111F possibly damaging Het
Cyp4f16 T A 17: 32,756,061 (GRCm39) I30N probably damaging Het
Ddc T G 11: 11,830,587 (GRCm39) D19A possibly damaging Het
Depdc1a T A 3: 159,222,537 (GRCm39) probably null Het
Evc2 T A 5: 37,574,828 (GRCm39) C1028S possibly damaging Het
Fam228a T C 12: 4,781,457 (GRCm39) E134G probably damaging Het
Fasl T C 1: 161,615,523 (GRCm39) E111G probably benign Het
Fbxw10 A G 11: 62,767,564 (GRCm39) N800S possibly damaging Het
Fras1 T C 5: 96,910,524 (GRCm39) S3318P probably damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gad1 T A 2: 70,409,545 (GRCm39) M212K probably damaging Het
Gm17455 T G 10: 60,238,752 (GRCm39) S6A probably benign Het
Grm5 T C 7: 87,779,997 (GRCm39) S1146P probably damaging Het
Gsn T C 2: 35,194,651 (GRCm39) L649P probably damaging Het
H2-DMb1 A G 17: 34,374,685 (GRCm39) T112A probably benign Het
Hcn3 T A 3: 89,060,201 (GRCm39) I148F probably damaging Het
Hdac10 T C 15: 89,009,961 (GRCm39) probably null Het
Hk3 C A 13: 55,156,518 (GRCm39) D619Y probably damaging Het
Ifi44 T A 3: 151,451,134 (GRCm39) R272S possibly damaging Het
Il1rap A C 16: 26,517,625 (GRCm39) D275A probably damaging Het
Irag2 A G 6: 145,113,710 (GRCm39) R293G possibly damaging Het
Itgam A T 7: 127,707,152 (GRCm39) N660I probably benign Het
Itpr3 T C 17: 27,332,793 (GRCm39) M1853T probably benign Het
Lrrc8c A C 5: 105,754,965 (GRCm39) K247Q probably damaging Het
Map3k21 T C 8: 126,668,858 (GRCm39) S815P probably benign Het
Mast4 A G 13: 102,888,068 (GRCm39) S1114P probably damaging Het
Myh8 C T 11: 67,194,591 (GRCm39) Q1601* probably null Het
Nhlrc2 A G 19: 56,558,959 (GRCm39) D148G probably damaging Het
Nos1 T A 5: 118,081,385 (GRCm39) S1196T probably benign Het
Nsmaf C T 4: 6,424,874 (GRCm39) probably null Het
Obscn T C 11: 58,890,449 (GRCm39) D7361G unknown Het
Or2t35 T C 14: 14,407,777 (GRCm38) V183A probably damaging Het
Or52ad1 C A 7: 102,996,085 (GRCm39) A17S probably benign Het
Or5bw2 C T 7: 6,573,359 (GRCm39) A123V probably damaging Het
Pank3 T G 11: 35,668,536 (GRCm39) M175R probably benign Het
Papolg A G 11: 23,829,868 (GRCm39) probably null Het
Pcdhb21 G A 18: 37,647,566 (GRCm39) D232N probably damaging Het
Pcdhb22 T C 18: 37,651,925 (GRCm39) F131S probably damaging Het
Pik3r6 G A 11: 68,419,608 (GRCm39) A140T possibly damaging Het
Pinlyp T C 7: 24,241,947 (GRCm39) T87A possibly damaging Het
Pld1 T C 3: 28,178,724 (GRCm39) S873P probably damaging Het
Pld5 T A 1: 176,102,295 (GRCm39) Y49F probably benign Het
Polq T C 16: 36,855,252 (GRCm39) V449A probably damaging Het
Prkca A G 11: 107,869,106 (GRCm39) V69A probably benign Het
Ptk6 A G 2: 180,844,075 (GRCm39) S75P possibly damaging Het
Ptprq G A 10: 107,418,391 (GRCm39) Q1662* probably null Het
Ptprt C A 2: 161,395,742 (GRCm39) A1144S probably damaging Het
Rrm1 T A 7: 102,116,133 (GRCm39) W684R probably damaging Het
Ryr1 T A 7: 28,735,500 (GRCm39) M4093L probably damaging Het
Scnn1a C T 6: 125,299,189 (GRCm39) L90F probably damaging Het
Slc25a19 G T 11: 115,508,423 (GRCm39) Y188* probably null Het
Slc31a1 C T 4: 62,303,866 (GRCm39) probably benign Het
Slc5a11 C G 7: 122,864,458 (GRCm39) S351R possibly damaging Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Spam1 T A 6: 24,797,837 (GRCm39) L331Q probably damaging Het
Spata32 A G 11: 103,100,125 (GRCm39) W127R probably damaging Het
Spring1 A G 5: 118,393,886 (GRCm39) E88G possibly damaging Het
Spta1 T G 1: 174,041,508 (GRCm39) I1324S probably damaging Het
St6galnac4 A G 2: 32,484,330 (GRCm39) Y176C probably damaging Het
Stk10 A G 11: 32,546,724 (GRCm39) E327G probably damaging Het
Stxbp5l T A 16: 36,954,646 (GRCm39) Y912F possibly damaging Het
Tchp G A 5: 114,858,243 (GRCm39) E459K probably benign Het
Terf2 C T 8: 107,822,842 (GRCm39) W100* probably null Het
Thoc2l T G 5: 104,666,077 (GRCm39) S200A probably benign Het
Thrsp T C 7: 97,066,634 (GRCm39) N26S probably damaging Het
Tln1 C A 4: 43,553,504 (GRCm39) R297L probably benign Het
Tmeff2 C A 1: 50,967,234 (GRCm39) T43N possibly damaging Het
Tmx1 C T 12: 70,499,947 (GRCm39) A2V possibly damaging Het
Tnks1bp1 T A 2: 84,902,481 (GRCm39) L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 (GRCm39) K107N probably damaging Het
Trpa1 A T 1: 14,955,972 (GRCm39) probably null Het
Trrap A G 5: 144,783,287 (GRCm39) K3371R probably damaging Het
Tuba3b G A 6: 145,563,995 (GRCm39) V14I probably benign Het
Usp19 T C 9: 108,371,439 (GRCm39) probably null Het
Usp28 C A 9: 48,950,401 (GRCm39) D615E possibly damaging Het
Utp20 T C 10: 88,657,931 (GRCm39) D43G probably benign Het
Vmn1r58 T G 7: 5,413,997 (GRCm39) K78Q possibly damaging Het
Vmn2r10 T C 5: 109,151,327 (GRCm39) M96V probably benign Het
Wdr90 T C 17: 26,079,023 (GRCm39) E273G probably damaging Het
Xpc C T 6: 91,468,208 (GRCm39) A860T probably benign Het
Zscan21 T C 5: 138,131,865 (GRCm39) I463T possibly damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTCCCAAGCTCCAGCCACTAAG -3'
(R):5'- CCGTTCCGTAAGGAATGAGACCATC -3'

Sequencing Primer
(F):5'- AGCCACTAAGCCTATCTCTGG -3'
(R):5'- GGAATGAGACCATCATCTTCCTCAG -3'
Posted On 2013-05-23