Mutagenetix > Incidental Mutations

Incidental Mutation 'R5205:Psme4'

398454

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

042780-MU

Accession Numbers

Genbank: NM_134013

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5205 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 30832666 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

Predicted Effect

probably benign
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142217

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150219

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (54/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,441	Y178*	probably null	Het
Adamts19	G	A	18: 58,968,808	R650Q	probably damaging	Het
Adgre4	G	T	17: 55,794,727	E216*	probably null	Het
Aldh6a1	T	A	12: 84,439,644	M167L	probably damaging	Het
Asb16	G	A	11: 102,268,994	D58N	probably damaging	Het
Cfap43	C	A	19: 47,897,548	L209F	possibly damaging	Het
Cfh	A	G	1: 140,143,970	C327R	probably damaging	Het
Chd7	T	A	4: 8,752,509	N335K	possibly damaging	Het
Clca3a1	T	C	3: 144,746,784	E646G	possibly damaging	Het
Col6a6	A	T	9: 105,782,033	V571D	probably damaging	Het
Cttnbp2	T	C	6: 18,427,433		probably benign	Het
Dennd1b	T	A	1: 139,054,568	S132T	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Dnaaf2	C	T	12: 69,192,924	V608I	probably damaging	Het
Edem3	A	T	1: 151,811,519	D717V	probably damaging	Het
Fam135a	T	C	1: 24,029,511	N589S	probably benign	Het
Gm13991	G	C	2: 116,528,200		noncoding transcript	Het
Gm16379	A	T	9: 14,845,472		noncoding transcript	Het
Ighv2-3	T	C	12: 113,611,275	S87G	probably benign	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcna2	T	C	3: 107,097,146		probably benign	Het
Klra4	T	A	6: 130,062,117	N104I	probably damaging	Het
Lrrc28	A	G	7: 67,531,768	S240P	probably benign	Het
Majin	T	C	19: 6,195,759	I27T	possibly damaging	Het
Mfhas1	G	A	8: 35,591,007	E879K	probably benign	Het
Msh4	A	G	3: 153,866,412	L583P	probably damaging	Het
Nrxn1	A	T	17: 90,163,874	N1234K	probably damaging	Het
Olfr1477	T	C	19: 13,502,799	L152P	probably damaging	Het
Orm1	T	C	4: 63,344,692	I32T	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Plppr2	A	T	9: 21,941,074	T85S	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,298	W604R	probably benign	Het
Prss56	G	T	1: 87,185,534	D195Y	probably damaging	Het
Rbm25	T	A	12: 83,672,869	D554E	probably benign	Het
Rbm6	A	G	9: 107,788,343	M618T	probably benign	Het
Slc17a5	A	G	9: 78,578,617	V62A	probably damaging	Het
Slk	T	A	19: 47,625,460	N918K	possibly damaging	Het
Syne1	C	A	10: 5,052,295	A8126S	probably benign	Het
Synj2	T	C	17: 5,941,518	L23S	probably damaging	Het
Taar2	A	C	10: 23,940,976	H138P	probably benign	Het
Taar7b	A	T	10: 24,000,018	E27V	probably benign	Het
Tbc1d2b	A	G	9: 90,207,810	Y889H	probably damaging	Het
Tmem43	T	C	6: 91,486,781	I346T	possibly damaging	Het
Ttc3	T	A	16: 94,448,059	C1139S	probably benign	Het
Txndc11	A	G	16: 11,128,665	V94A	probably damaging	Het
Ush2a	T	A	1: 188,874,936	H4009Q	probably benign	Het
Wnk4	A	G	11: 101,265,138	E407G	possibly damaging	Het
Ybx1	G	T	4: 119,279,151	D261E	probably damaging	Het
Zfp985	A	T	4: 147,582,911	I79F	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	intron	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	intron	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	intron	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	intron	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACAGCTCCATAATTGTTAATGTGC -3'
(R):5'- AGGATCCACTTGATATGTTTCCTGC -3'

Sequencing Primer
(F):5'- CTCCATAATTGTTAATGTGCTTTGGC -3'
(R):5'- TGTTTCCTGCTTATAATCGACATAC -3'

Posted On

2016-07-06