Incidental Mutation 'R5205:1110008L16Rik'
List |< first << previous [record 186 of 468117] next >> last >|
ID398462
Institutional Source Beutler Lab
Gene Symbol 1110008L16Rik
Ensembl Gene ENSMUSG00000021023
Gene NameRIKEN cDNA 1110008L16 gene
Synonyms
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55299577-55382533 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 55304441 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 178 (Y178*)
Ref Sequence ENSEMBL: ENSMUSP00000139204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410] [ENSMUST00000021411] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021411
AA Change: Y178*
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023
AA Change: Y178*

DomainStartEndE-ValueType
Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183475
AA Change: Y178*
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023
AA Change: Y178*

DomainStartEndE-ValueType
low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184249
Predicted Effect probably null
Transcript: ENSMUST00000184766
AA Change: Y178*
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023
AA Change: Y178*

DomainStartEndE-ValueType
PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218116
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in 1110008L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:1110008L16Rik APN 12 55308875 splice site probably benign
IGL01932:1110008L16Rik APN 12 55304125 missense probably benign
IGL03030:1110008L16Rik APN 12 55304644 missense probably damaging 1.00
R0102:1110008L16Rik UTSW 12 55382297 missense probably benign 0.37
R0892:1110008L16Rik UTSW 12 55382248 splice site probably null
R1479:1110008L16Rik UTSW 12 55379387 missense probably damaging 1.00
R1510:1110008L16Rik UTSW 12 55304212 missense probably benign 0.21
R1845:1110008L16Rik UTSW 12 55304332 missense possibly damaging 0.58
R1992:1110008L16Rik UTSW 12 55338206 missense probably damaging 1.00
R2307:1110008L16Rik UTSW 12 55304316 missense probably damaging 1.00
R4080:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4081:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4082:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R5590:1110008L16Rik UTSW 12 55304472 missense possibly damaging 0.89
R5940:1110008L16Rik UTSW 12 55304874 missense probably damaging 1.00
R5988:1110008L16Rik UTSW 12 55377217 missense probably damaging 1.00
R6147:1110008L16Rik UTSW 12 55379308 missense probably damaging 0.99
R7208:1110008L16Rik UTSW 12 55308645 intron probably null
R7220:1110008L16Rik UTSW 12 55304415 missense possibly damaging 0.79
R7304:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7316:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7502:1110008L16Rik UTSW 12 55304421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAATTCCGCAGAGTGGG -3'
(R):5'- GGGCTCCTTGTATACAGTCAC -3'

Sequencing Primer
(F):5'- TTTGAATTCCGCAGAGTGGGATAAAC -3'
(R):5'- GGGCTCCTTGTATACAGTCACCATAG -3'
Posted On2016-07-06