Mutagenetix > Incidental Mutation

Incidental Mutation 'R5205:Adamts19'

398482

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

042780-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5205 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58968808 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 650 (R650Q)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: R650Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: R650Q

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.1770

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,441	Y178*	probably null	Het
Adgre4	G	T	17: 55,794,727	E216*	probably null	Het
Aldh6a1	T	A	12: 84,439,644	M167L	probably damaging	Het
Asb16	G	A	11: 102,268,994	D58N	probably damaging	Het
Cfap43	C	A	19: 47,897,548	L209F	possibly damaging	Het
Cfh	A	G	1: 140,143,970	C327R	probably damaging	Het
Chd7	T	A	4: 8,752,509	N335K	possibly damaging	Het
Clca3a1	T	C	3: 144,746,784	E646G	possibly damaging	Het
Col6a6	A	T	9: 105,782,033	V571D	probably damaging	Het
Cttnbp2	T	C	6: 18,427,433		probably benign	Het
Dennd1b	T	A	1: 139,054,568	S132T	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Dnaaf2	C	T	12: 69,192,924	V608I	probably damaging	Het
Edem3	A	T	1: 151,811,519	D717V	probably damaging	Het
Fam135a	T	C	1: 24,029,511	N589S	probably benign	Het
Gm13991	G	C	2: 116,528,200		noncoding transcript	Het
Gm16379	A	T	9: 14,845,472		noncoding transcript	Het
Ighv2-3	T	C	12: 113,611,275	S87G	probably benign	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcna2	T	C	3: 107,097,146		probably benign	Het
Klra4	T	A	6: 130,062,117	N104I	probably damaging	Het
Lrrc28	A	G	7: 67,531,768	S240P	probably benign	Het
Majin	T	C	19: 6,195,759	I27T	possibly damaging	Het
Mfhas1	G	A	8: 35,591,007	E879K	probably benign	Het
Msh4	A	G	3: 153,866,412	L583P	probably damaging	Het
Nrxn1	A	T	17: 90,163,874	N1234K	probably damaging	Het
Olfr1477	T	C	19: 13,502,799	L152P	probably damaging	Het
Orm1	T	C	4: 63,344,692	I32T	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Plppr2	A	T	9: 21,941,074	T85S	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,298	W604R	probably benign	Het
Prss56	G	T	1: 87,185,534	D195Y	probably damaging	Het
Psme4	T	A	11: 30,832,666		probably benign	Het
Rbm25	T	A	12: 83,672,869	D554E	probably benign	Het
Rbm6	A	G	9: 107,788,343	M618T	probably benign	Het
Slc17a5	A	G	9: 78,578,617	V62A	probably damaging	Het
Slk	T	A	19: 47,625,460	N918K	possibly damaging	Het
Syne1	C	A	10: 5,052,295	A8126S	probably benign	Het
Synj2	T	C	17: 5,941,518	L23S	probably damaging	Het
Taar2	A	C	10: 23,940,976	H138P	probably benign	Het
Taar7b	A	T	10: 24,000,018	E27V	probably benign	Het
Tbc1d2b	A	G	9: 90,207,810	Y889H	probably damaging	Het
Tmem43	T	C	6: 91,486,781	I346T	possibly damaging	Het
Ttc3	T	A	16: 94,448,059	C1139S	probably benign	Het
Txndc11	A	G	16: 11,128,665	V94A	probably damaging	Het
Ush2a	T	A	1: 188,874,936	H4009Q	probably benign	Het
Wnk4	A	G	11: 101,265,138	E407G	possibly damaging	Het
Ybx1	G	T	4: 119,279,151	D261E	probably damaging	Het
Zfp985	A	T	4: 147,582,911	I79F	probably damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- GCATTAATTCCAGTGACTGTGTAG -3'
(R):5'- TGAAAGCCTGATCACTGTTTGC -3'

Sequencing Primer
(F):5'- ATTCCAGTGACTGTGTAGACCAG -3'
(R):5'- CACTGTTTGCTTCTTAAAGGAGACG -3'

Posted On

2016-07-06