Mutagenetix > Incidental Mutations

Incidental Mutation 'R5237:Plch2'

398503

Institutional Source

Beutler Lab

Gene Symbol

Plch2

Ensembl Gene

ENSMUSG00000029055

Gene Name

phospholipase C, eta 2

Synonyms

Plcl4, A930027K05Rik, PLCeta2

MMRRC Submission

042808-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5237 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154983115-155056784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155010794 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 64 (V64A)

Ref Sequence

ENSEMBL: ENSMUSP00000122704 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000126098] [ENSMUST00000131173] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000145662] [ENSMUST00000176194] [ENSMUST00000186598]

Predicted Effect

probably benign
Transcript: ENSMUST00000105631
AA Change: V64A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: V64A

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	1.7e-26	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1088	1107	N/A	INTRINSIC
low complexity region	1227	1236	N/A	INTRINSIC
low complexity region	1356	1369	N/A	INTRINSIC
low complexity region	1421	1451	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126098

SMART Domains

Protein: ENSMUSP00000115440
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
SCOP:d1mai__	39	58	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131173

SMART Domains

Protein: ENSMUSP00000118629
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
Blast:PH	31	111	6e-49	BLAST
SCOP:d1mai__	34	111	4e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135665

SMART Domains

Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
PH	17	126	1.8e-6	SMART
EFh	142	170	7.29e-4	SMART
EFh	178	207	4.67e-2	SMART
Pfam:EF-hand_like	212	294	2.8e-25	PFAM
PLCXc	295	440	6.76e-76	SMART
low complexity region	454	467	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
PLCYc	602	716	1.25e-56	SMART
C2	735	843	1.66e-21	SMART
low complexity region	983	1002	N/A	INTRINSIC
low complexity region	1122	1131	N/A	INTRINSIC
low complexity region	1251	1264	N/A	INTRINSIC
low complexity region	1316	1346	N/A	INTRINSIC
low complexity region	1349	1361	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139976
AA Change: V64A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: V64A

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	3.2e-27	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1087	1100	N/A	INTRINSIC
low complexity region	1166	1194	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145662

SMART Domains

Protein: ENSMUSP00000119864
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
PH	46	155	1.8e-6	SMART
EFh	171	199	7.29e-4	SMART
EFh	207	236	4.67e-2	SMART
Pfam:EF-hand_like	241	323	5.2e-27	PFAM
PLCXc	324	469	6.76e-76	SMART
low complexity region	483	496	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175982

Predicted Effect

probably benign
Transcript: ENSMUST00000176194

SMART Domains

Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
PH	21	130	1.8e-6	SMART
EFh	146	174	7.29e-4	SMART
EFh	182	211	4.67e-2	SMART
Pfam:EF-hand_like	216	298	1.6e-25	PFAM
PLCXc	299	444	6.76e-76	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	558	575	N/A	INTRINSIC
PLCYc	606	720	1.25e-56	SMART
C2	739	847	1.66e-21	SMART
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1065	1093	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186598

SMART Domains

Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	79	189	5.8e-18	SMART
low complexity region	328	341	N/A	INTRINSIC
low complexity region	407	435	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	G	A	4: 144,623,280	W369*	probably null	Het
Adamts3	A	T	5: 89,775,377	M190K	probably benign	Het
Adamtsl1	T	C	4: 86,385,669		probably null	Het
Adcy1	A	T	11: 7,149,553	I678L	probably benign	Het
Agtrap	A	G	4: 148,082,360	S27P	probably benign	Het
Ankrd24	C	A	10: 81,642,545		probably benign	Het
Atg2a	G	T	19: 6,246,814	V383L	probably benign	Het
Ccdc40	T	C	11: 119,259,976	V1105A	probably benign	Het
Cenpf	A	T	1: 189,659,533	S684T	probably benign	Het
Cog7	A	G	7: 121,951,221	L360P	probably damaging	Het
Col12a1	T	A	9: 79,700,262	Q428L	probably benign	Het
Col4a1	G	A	8: 11,245,068		probably benign	Het
Cpeb2	G	A	5: 43,285,756	C930Y	probably damaging	Het
Cul9	T	C	17: 46,543,467	D103G	probably benign	Het
Cyb5a	T	G	18: 84,871,564	F39L	probably damaging	Het
Cyp2d12	T	A	15: 82,558,006		probably null	Het
Dnah7a	A	C	1: 53,447,531		probably null	Het
Efcab9	A	T	11: 32,522,832	I205K	probably benign	Het
Ezh1	A	G	11: 101,216,993		probably null	Het
Galnt6	C	A	15: 100,693,393	C610F	probably damaging	Het
Gata4	C	T	14: 63,240,626	A175T	probably benign	Het
Gcc1	A	T	6: 28,420,652	I222K	probably benign	Het
Gm13119	G	T	4: 144,362,471	E120*	probably null	Het
Gm5591	T	A	7: 38,522,207	H146L	probably benign	Het
H2-T23	C	T	17: 36,030,366		probably null	Het
Hmcn2	T	A	2: 31,414,716	I3124N	probably benign	Het
Hsf2	C	A	10: 57,506,221	D364E	probably benign	Het
Il15ra	A	G	2: 11,733,205	T250A	possibly damaging	Het
Large2	T	C	2: 92,367,142	E372G	probably benign	Het
Map2	A	G	1: 66,439,010		probably benign	Het
Med24	T	C	11: 98,710,783	Y524C	probably damaging	Het
Mfsd6l	C	A	11: 68,557,270	Q316K	probably benign	Het
Mroh6	T	C	15: 75,885,991	T417A	possibly damaging	Het
Mymk	T	C	2: 27,062,188	*181W	probably null	Het
Nup210l	A	G	3: 90,180,198	T1093A	probably benign	Het
Olfr120	T	A	17: 37,726,377	C118S	probably damaging	Het
Olfr692	A	T	7: 105,369,306	K327*	probably null	Het
Olfr796	A	G	10: 129,607,863	V206A	probably benign	Het
Olfr921	C	T	9: 38,775,956	R234W	probably damaging	Het
Papola	T	C	12: 105,826,960	V513A	probably benign	Het
Pex26	T	A	6: 121,185,847	L119Q	probably damaging	Het
Phldb2	T	C	16: 45,747,886	I1219V	probably damaging	Het
Plekho1	A	G	3: 95,995,625	V24A	probably damaging	Het
Pon2	A	C	6: 5,265,455	S311A	probably benign	Het
Rsrc2	T	C	5: 123,739,582		probably benign	Het
Selenov	T	C	7: 28,288,147	D295G	probably damaging	Het
Serpina10	T	A	12: 103,628,816	Y48F	probably benign	Het
Setbp1	T	A	18: 78,856,975	D1159V	possibly damaging	Het
Setx	C	T	2: 29,146,983	T1160I	probably benign	Het
Sin3b	A	C	8: 72,733,343		probably null	Het
Skint11	A	G	4: 114,244,845	K352E	possibly damaging	Het
Slitrk5	T	A	14: 111,681,686	V914E	possibly damaging	Het
Srgap1	A	G	10: 121,807,883	Y633H	probably damaging	Het
Stard9	A	G	2: 120,699,358	D2032G	probably damaging	Het
Sv2c	G	A	13: 95,981,883	T486I	possibly damaging	Het
Tesk1	T	C	4: 43,447,100	F496S	probably damaging	Het
Tfg	T	A	16: 56,712,708	E29D	possibly damaging	Het
Tnc	G	A	4: 63,962,096	T2038I	probably damaging	Het
Tor4a	T	G	2: 25,194,964	N309T	probably damaging	Het
Trim69	A	G	2: 122,173,340	T257A	probably benign	Het
Trpm6	C	T	19: 18,813,464	A621V	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r6	A	C	6: 57,003,194	Q258H	probably damaging	Het
Vmn2r84	A	G	10: 130,385,994	C786R	probably damaging	Het
Xylt2	T	C	11: 94,667,127	D638G	probably benign	Het
Zfp934	A	G	13: 62,517,838	C330R	probably damaging	Het

Other mutations in Plch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Plch2	APN	4	155006642	missense	probably damaging	1.00
IGL02024:Plch2	APN	4	155043138	intron	probably benign
IGL02580:Plch2	APN	4	154984764	missense	probably benign	0.03
IGL03370:Plch2	APN	4	154986914	missense	probably benign	0.18
IGL03407:Plch2	APN	4	154989798	missense	probably damaging	1.00
tolerant	UTSW	4	154984635	missense	probably benign	0.01
PIT4418001:Plch2	UTSW	4	154989503	missense	probably damaging	1.00
PIT4445001:Plch2	UTSW	4	155009026	missense	probably damaging	1.00
R0117:Plch2	UTSW	4	154985358	unclassified	probably benign
R0347:Plch2	UTSW	4	154986721	missense	possibly damaging	0.91
R0361:Plch2	UTSW	4	155006711	missense	possibly damaging	0.95
R0413:Plch2	UTSW	4	155006916	critical splice donor site	probably null
R0487:Plch2	UTSW	4	155009012	missense	probably damaging	1.00
R0514:Plch2	UTSW	4	154998886	missense	probably damaging	1.00
R0734:Plch2	UTSW	4	154996283	missense	probably damaging	1.00
R0766:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1306:Plch2	UTSW	4	155007140	missense	probably damaging	1.00
R1312:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1602:Plch2	UTSW	4	154984450	missense	probably damaging	0.99
R1717:Plch2	UTSW	4	154998272	missense	probably benign
R1731:Plch2	UTSW	4	155006994	missense	possibly damaging	0.83
R1769:Plch2	UTSW	4	155000083	missense	probably damaging	1.00
R1875:Plch2	UTSW	4	154998508	missense	probably damaging	1.00
R1974:Plch2	UTSW	4	154984953	missense	possibly damaging	0.77
R2031:Plch2	UTSW	4	155043027	intron	probably benign
R2050:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R2061:Plch2	UTSW	4	155042841	intron	probably benign
R2073:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2075:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2109:Plch2	UTSW	4	154984597	missense	possibly damaging	0.92
R2126:Plch2	UTSW	4	154998999	missense	probably damaging	1.00
R2265:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2266:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2269:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2280:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2281:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2432:Plch2	UTSW	4	154986164	makesense	probably null
R2971:Plch2	UTSW	4	154990767	missense	probably benign	0.29
R3437:Plch2	UTSW	4	154991013	critical splice donor site	probably null
R3980:Plch2	UTSW	4	154984798	missense	probably benign	0.00
R4757:Plch2	UTSW	4	154996233	missense	possibly damaging	0.88
R4827:Plch2	UTSW	4	154991113	missense	probably damaging	1.00
R4828:Plch2	UTSW	4	154984635	missense	probably benign	0.01
R4869:Plch2	UTSW	4	154989428	missense	probably benign	0.28
R5020:Plch2	UTSW	4	155007083	missense	probably damaging	1.00
R5050:Plch2	UTSW	4	155043309	intron	probably benign
R5126:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R5274:Plch2	UTSW	4	154998954	missense	probably damaging	1.00
R5296:Plch2	UTSW	4	154989999	splice site	probably null
R5324:Plch2	UTSW	4	154984534	missense	probably benign
R5475:Plch2	UTSW	4	155000137	missense	probably damaging	1.00
R5494:Plch2	UTSW	4	154991122	missense	probably damaging	1.00
R5811:Plch2	UTSW	4	154992567	missense	possibly damaging	0.62
R6083:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R6092:Plch2	UTSW	4	154984372	missense	probably benign	0.02
R6253:Plch2	UTSW	4	155007101	missense	probably damaging	1.00
R6456:Plch2	UTSW	4	154993002	missense	probably damaging	1.00
R7038:Plch2	UTSW	4	154990032	splice site	probably null
R7084:Plch2	UTSW	4	154986991	missense	probably benign	0.31
R7210:Plch2	UTSW	4	155009086	missense	probably damaging	1.00
R7216:Plch2	UTSW	4	154984228	missense	probably benign
R7264:Plch2	UTSW	4	154998967	missense	probably damaging	0.98
R7291:Plch2	UTSW	4	154998472	missense	probably damaging	1.00
R7423:Plch2	UTSW	4	154983737	missense	probably damaging	1.00
R7436:Plch2	UTSW	4	154984096	missense	probably benign	0.01
R7438:Plch2	UTSW	4	155000460	missense	probably damaging	1.00
R7594:Plch2	UTSW	4	155007027	missense	probably damaging	1.00
R7663:Plch2	UTSW	4	154991162	missense	probably damaging	0.96
R7698:Plch2	UTSW	4	155002787	missense	possibly damaging	0.95
R7844:Plch2	UTSW	4	154989465	missense	probably damaging	1.00
R7939:Plch2	UTSW	4	155002778	missense	possibly damaging	0.91
R8003:Plch2	UTSW	4	155054523	missense	unknown
R8007:Plch2	UTSW	4	155002831	missense	probably damaging	1.00
R8281:Plch2	UTSW	4	155006973	missense	probably benign	0.07
R8434:Plch2	UTSW	4	154989735	missense	probably damaging	1.00
R8504:Plch2	UTSW	4	154984395	missense	probably benign	0.31
R8516:Plch2	UTSW	4	154986307	missense	probably benign
RF014:Plch2	UTSW	4	155007120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCTATGCATCCTGTGGC -3'
(R):5'- TAGGCCTGGAGGTTCTAGAG -3'

Sequencing Primer
(F):5'- ATGCATCCTGTGGCCCCATAG -3'
(R):5'- TTCTAGAGGATGGGCGGAC -3'

Posted On

2016-07-06