Incidental Mutation 'R5231:Bche'
ID398504
Institutional Source Beutler Lab
Gene Symbol Bche
Ensembl Gene ENSMUSG00000027792
Gene Namebutyrylcholinesterase
SynonymsC730038G20Rik
MMRRC Submission 042803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5231 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73635808-73708415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73700861 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 411 (P411S)
Ref Sequence ENSEMBL: ENSMUSP00000029367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029367] [ENSMUST00000138216]
Predicted Effect probably benign
Transcript: ENSMUST00000029367
AA Change: P411S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029367
Gene: ENSMUSG00000027792
AA Change: P411S

DomainStartEndE-ValueType
Pfam:COesterase 10 551 5.2e-183 PFAM
Pfam:Abhydrolase_3 139 242 1.9e-7 PFAM
Pfam:AChE_tetra 566 602 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133690
Predicted Effect probably benign
Transcript: ENSMUST00000138216
SMART Domains Protein: ENSMUSP00000141329
Gene: ENSMUSG00000027792

DomainStartEndE-ValueType
Pfam:COesterase 10 174 6.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153917
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,951 H716L possibly damaging Het
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Chil3 A G 3: 106,155,729 S182P probably damaging Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-53 C A 12: 115,158,605 S50I probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Klk1b16 T A 7: 44,137,347 L10Q probably damaging Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr1499 A T 19: 13,815,347 I81N probably damaging Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr394 C A 11: 73,887,955 C139F probably damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Stat2 T C 10: 128,281,242 probably null Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in Bche
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Bche APN 3 73701307 missense probably benign 0.00
IGL01420:Bche APN 3 73702009 missense probably benign 0.03
IGL02433:Bche APN 3 73701929 missense probably benign 0.02
IGL02734:Bche APN 3 73702076 missense probably benign 0.09
IGL03095:Bche APN 3 73701883 missense probably damaging 1.00
IGL03227:Bche APN 3 73701612 missense probably damaging 1.00
R0056:Bche UTSW 3 73701321 missense possibly damaging 0.79
R1780:Bche UTSW 3 73700620 missense probably benign 0.00
R1984:Bche UTSW 3 73701826 missense probably benign 0.03
R1984:Bche UTSW 3 73701827 missense probably benign
R2403:Bche UTSW 3 73701472 missense probably damaging 0.96
R4989:Bche UTSW 3 73701844 missense probably benign 0.02
R5363:Bche UTSW 3 73700639 missense probably damaging 0.98
R5987:Bche UTSW 3 73648678 missense possibly damaging 0.59
R6164:Bche UTSW 3 73701056 missense possibly damaging 0.63
R6381:Bche UTSW 3 73701799 missense probably benign 0.00
R6571:Bche UTSW 3 73701491 missense probably benign 0.08
R6801:Bche UTSW 3 73701800 missense probably benign
R6935:Bche UTSW 3 73701800 missense probably benign
R7275:Bche UTSW 3 73700636 missense probably benign 0.19
R7499:Bche UTSW 3 73701898 missense probably damaging 1.00
R7543:Bche UTSW 3 73701733 missense probably damaging 1.00
R7757:Bche UTSW 3 73701121 missense probably damaging 1.00
R7965:Bche UTSW 3 73701816 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATAGCCATGCATCACTCC -3'
(R):5'- GGATGGCGATTTTCTCACCG -3'

Sequencing Primer
(F):5'- CCATCCATTCCGGCCAAGG -3'
(R):5'- AGCTCAGATCTTAGTGGGAGTTAAC -3'
Posted On2016-07-06