Mutagenetix > Incidental Mutations

Incidental Mutation 'R5231:Chil3'

398506

Institutional Source

Beutler Lab

Gene Symbol

Chil3

Ensembl Gene

ENSMUSG00000040809

Gene Name

chitinase-like 3

Synonyms

Ym1, Chi3l3

MMRRC Submission

042803-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R5231 (G1)

Quality Score

150

Status

Not validated

Chromosome

Chromosomal Location

106147554-106167564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106155729 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 182 (S182P)

Ref Sequence

ENSEMBL: ENSMUSP00000053923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063062]

PDB Structure

THE CRYSTAL STRUCTURE OF NOVEL MAMMALIAN LECTIN YM1 SUGGESTS A SACCHARIDE BINDING SITE [X-RAY DIFFRACTION]
The Crystal Structure of Ym1 at 1.31 A Resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000063062
AA Change: S182P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000053923
Gene: ENSMUSG00000040809
AA Change: S182P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	365	5.17e-134	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129563

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is thought to function as a lectin and may be involved in inflammation and allergy. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,683,951	H716L	possibly damaging	Het
9130019O22Rik	T	C	7: 127,385,414	Y172C	probably damaging	Het
Adat3	T	C	10: 80,606,426	S33P	possibly damaging	Het
Bche	G	A	3: 73,700,861	P411S	probably benign	Het
Col6a4	T	C	9: 106,025,531	E1653G	probably damaging	Het
Csk	G	T	9: 57,630,378	H84Q	probably damaging	Het
Csmd2	A	G	4: 128,546,049	T3099A	probably benign	Het
Deup1	G	T	9: 15,575,199	A395E	probably damaging	Het
Frem2	T	C	3: 53,522,295	Y2778C	probably damaging	Het
Gm10020	T	C	15: 52,478,044		noncoding transcript	Het
Igfn1	T	C	1: 135,966,736	T2031A	probably benign	Het
Ighv1-53	C	A	12: 115,158,605	S50I	probably benign	Het
Ighv1-62-3	A	T	12: 115,461,051	M100K	possibly damaging	Het
Igkv2-109	T	A	6: 68,302,445	F3I	probably benign	Het
Isl1	T	C	13: 116,301,657	D296G	probably benign	Het
Klk1b16	T	A	7: 44,137,347	L10Q	probably damaging	Het
Kmt2c	A	T	5: 25,315,473	S1880T	possibly damaging	Het
Lhcgr	T	A	17: 88,755,611	N211I	probably damaging	Het
Ltb	C	T	17: 35,195,826	L201F	probably damaging	Het
Mfsd2a	A	G	4: 122,959,301	F64S	possibly damaging	Het
Mmp10	T	C	9: 7,502,500		probably null	Het
Mycbp2	A	C	14: 103,346,214		probably null	Het
Olfr1499	A	T	19: 13,815,347	I81N	probably damaging	Het
Olfr181	T	C	16: 58,925,714	I286V	possibly damaging	Het
Olfr394	C	A	11: 73,887,955	C139F	probably damaging	Het
Olfr589	A	T	7: 103,154,968	F260I	probably damaging	Het
Peg10	C	T	6: 4,756,939		probably benign	Het
Plscr1	C	A	9: 92,266,731	P208H	probably damaging	Het
Rhot1	T	C	11: 80,227,334		probably null	Het
Smarcc2	T	C	10: 128,461,352	Y38H	probably damaging	Het
Stat2	T	C	10: 128,281,242		probably null	Het
Trip11	T	C	12: 101,885,601	K735E	probably damaging	Het
Ttll1	T	A	15: 83,489,466		probably null	Het
Vmn2r37	C	A	7: 9,206,595	L639F	possibly damaging	Het
Vmn2r60	A	T	7: 42,137,024	Q417L	possibly damaging	Het
Vps8	A	T	16: 21,576,725	D1255V	probably damaging	Het
Zfp354b	A	C	11: 50,923,090	I336S	probably benign	Het

Other mutations in Chil3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Chil3	APN	3	106148701	missense	probably damaging	1.00
IGL01552:Chil3	APN	3	106148848	missense	probably damaging	0.98
IGL02538:Chil3	APN	3	106164129	missense	probably damaging	1.00
PIT4382001:Chil3	UTSW	3	106148659	missense	probably damaging	1.00
R0145:Chil3	UTSW	3	106160478	missense	probably damaging	1.00
R0269:Chil3	UTSW	3	106155756	missense	probably benign	0.00
R0310:Chil3	UTSW	3	106160523	missense	possibly damaging	0.75
R0453:Chil3	UTSW	3	106148905	missense	probably benign	0.26
R0541:Chil3	UTSW	3	106161232	critical splice acceptor site	probably null
R0617:Chil3	UTSW	3	106155756	missense	probably benign	0.00
R0831:Chil3	UTSW	3	106149747	missense	probably benign	0.19
R1699:Chil3	UTSW	3	106160366	critical splice donor site	probably null
R1851:Chil3	UTSW	3	106148801	critical splice donor site	probably null
R1852:Chil3	UTSW	3	106148801	critical splice donor site	probably null
R2105:Chil3	UTSW	3	106160478	missense	possibly damaging	0.73
R2202:Chil3	UTSW	3	106164246	missense	probably benign	0.11
R2204:Chil3	UTSW	3	106164246	missense	probably benign	0.11
R2205:Chil3	UTSW	3	106164246	missense	probably benign	0.11
R4358:Chil3	UTSW	3	106160499	nonsense	probably null
R4492:Chil3	UTSW	3	106155701	missense	probably damaging	1.00
R4543:Chil3	UTSW	3	106160370	missense	probably benign
R4554:Chil3	UTSW	3	106160370	missense	probably benign
R4930:Chil3	UTSW	3	106164208	missense	possibly damaging	0.67
R5011:Chil3	UTSW	3	106150161	missense	possibly damaging	0.46
R5083:Chil3	UTSW	3	106164089	critical splice donor site	probably null
R5423:Chil3	UTSW	3	106148662	missense	probably damaging	1.00
R6804:Chil3	UTSW	3	106164179	nonsense	probably null
R6859:Chil3	UTSW	3	106160414	missense	probably benign	0.14
R7218:Chil3	UTSW	3	106160537	splice site	probably null
R7391:Chil3	UTSW	3	106164180	missense	probably damaging	1.00
R7426:Chil3	UTSW	3	106155706	missense	probably benign	0.05
R7582:Chil3	UTSW	3	106164256	missense	probably damaging	1.00
R7620:Chil3	UTSW	3	106160435	missense	probably damaging	1.00
R7647:Chil3	UTSW	3	106148806	missense	possibly damaging	0.73
R7749:Chil3	UTSW	3	106148845	missense	probably benign	0.22
R7944:Chil3	UTSW	3	106150148	nonsense	probably null
R8099:Chil3	UTSW	3	106148668	missense	probably damaging	1.00
R8181:Chil3	UTSW	3	106149887	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAGGGCCATTTTCCTTCCTATGTAG -3'
(R):5'- CTTTGAACAGACATTGGAGTTCC -3'

Sequencing Primer
(F):5'- TTCCTATGTAGTCAAAGCATACCC -3'
(R):5'- TGCGTAAAGCTTTTGAGG -3'

Posted On

2016-07-06