Incidental Mutation 'R5231:Chil3'
ID398506
Institutional Source Beutler Lab
Gene Symbol Chil3
Ensembl Gene ENSMUSG00000040809
Gene Namechitinase-like 3
SynonymsYm1, Chi3l3
MMRRC Submission 042803-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R5231 (G1)
Quality Score150
Status Not validated
Chromosome3
Chromosomal Location106147554-106167564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106155729 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 182 (S182P)
Ref Sequence ENSEMBL: ENSMUSP00000053923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063062]
PDB Structure
THE CRYSTAL STRUCTURE OF NOVEL MAMMALIAN LECTIN YM1 SUGGESTS A SACCHARIDE BINDING SITE [X-RAY DIFFRACTION]
The Crystal Structure of Ym1 at 1.31 A Resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000063062
AA Change: S182P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053923
Gene: ENSMUSG00000040809
AA Change: S182P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 5.17e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129563
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is thought to function as a lectin and may be involved in inflammation and allergy. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,951 H716L possibly damaging Het
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Bche G A 3: 73,700,861 P411S probably benign Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-53 C A 12: 115,158,605 S50I probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Klk1b16 T A 7: 44,137,347 L10Q probably damaging Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr1499 A T 19: 13,815,347 I81N probably damaging Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr394 C A 11: 73,887,955 C139F probably damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Stat2 T C 10: 128,281,242 probably null Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in Chil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chil3 APN 3 106148701 missense probably damaging 1.00
IGL01552:Chil3 APN 3 106148848 missense probably damaging 0.98
IGL02538:Chil3 APN 3 106164129 missense probably damaging 1.00
PIT4382001:Chil3 UTSW 3 106148659 missense probably damaging 1.00
R0145:Chil3 UTSW 3 106160478 missense probably damaging 1.00
R0269:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0310:Chil3 UTSW 3 106160523 missense possibly damaging 0.75
R0453:Chil3 UTSW 3 106148905 missense probably benign 0.26
R0541:Chil3 UTSW 3 106161232 critical splice acceptor site probably null
R0617:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0831:Chil3 UTSW 3 106149747 missense probably benign 0.19
R1699:Chil3 UTSW 3 106160366 critical splice donor site probably null
R1851:Chil3 UTSW 3 106148801 critical splice donor site probably null
R1852:Chil3 UTSW 3 106148801 critical splice donor site probably null
R2105:Chil3 UTSW 3 106160478 missense possibly damaging 0.73
R2202:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2204:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2205:Chil3 UTSW 3 106164246 missense probably benign 0.11
R4358:Chil3 UTSW 3 106160499 nonsense probably null
R4492:Chil3 UTSW 3 106155701 missense probably damaging 1.00
R4543:Chil3 UTSW 3 106160370 missense probably benign
R4554:Chil3 UTSW 3 106160370 missense probably benign
R4930:Chil3 UTSW 3 106164208 missense possibly damaging 0.67
R5011:Chil3 UTSW 3 106150161 missense possibly damaging 0.46
R5083:Chil3 UTSW 3 106164089 critical splice donor site probably null
R5423:Chil3 UTSW 3 106148662 missense probably damaging 1.00
R6804:Chil3 UTSW 3 106164179 nonsense probably null
R6859:Chil3 UTSW 3 106160414 missense probably benign 0.14
R7218:Chil3 UTSW 3 106160537 splice site probably null
R7391:Chil3 UTSW 3 106164180 missense probably damaging 1.00
R7426:Chil3 UTSW 3 106155706 missense probably benign 0.05
R7582:Chil3 UTSW 3 106164256 missense probably damaging 1.00
R7620:Chil3 UTSW 3 106160435 missense probably damaging 1.00
R7647:Chil3 UTSW 3 106148806 missense possibly damaging 0.73
R7749:Chil3 UTSW 3 106148845 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TAGGGCCATTTTCCTTCCTATGTAG -3'
(R):5'- CTTTGAACAGACATTGGAGTTCC -3'

Sequencing Primer
(F):5'- TTCCTATGTAGTCAAAGCATACCC -3'
(R):5'- TGCGTAAAGCTTTTGAGG -3'
Posted On2016-07-06