Incidental Mutation 'R5231:Klk1b16'
ID398520
Institutional Source Beutler Lab
Gene Symbol Klk1b16
Ensembl Gene ENSMUSG00000038968
Gene Namekallikrein 1-related peptidase b16
SynonymsKlk16, mGk-16
MMRRC Submission 042803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5231 (G1)
Quality Score219
Status Not validated
Chromosome7
Chromosomal Location44136767-44141610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44137347 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 10 (L10Q)
Ref Sequence ENSEMBL: ENSMUSP00000005933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005933]
Predicted Effect probably damaging
Transcript: ENSMUST00000005933
AA Change: L10Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005933
Gene: ENSMUSG00000038968
AA Change: L10Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 7.64e-80 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206376
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,951 H716L possibly damaging Het
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Bche G A 3: 73,700,861 P411S probably benign Het
Chil3 A G 3: 106,155,729 S182P probably damaging Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-53 C A 12: 115,158,605 S50I probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr1499 A T 19: 13,815,347 I81N probably damaging Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr394 C A 11: 73,887,955 C139F probably damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Stat2 T C 10: 128,281,242 probably null Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in Klk1b16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Klk1b16 APN 7 44140678 missense probably damaging 0.98
IGL01529:Klk1b16 APN 7 44140739 missense probably benign 0.18
R1105:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1106:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1559:Klk1b16 UTSW 7 44141001 missense probably benign 0.00
R3883:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R3884:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R4152:Klk1b16 UTSW 7 44140549 missense probably benign 0.09
R4398:Klk1b16 UTSW 7 44141427 missense probably damaging 1.00
R5389:Klk1b16 UTSW 7 44140988 missense possibly damaging 0.83
R5470:Klk1b16 UTSW 7 44137331 missense probably damaging 0.99
R5532:Klk1b16 UTSW 7 44141526 missense probably benign 0.00
R5690:Klk1b16 UTSW 7 44140894 critical splice acceptor site probably null
R5717:Klk1b16 UTSW 7 44139489 missense probably benign 0.00
R5749:Klk1b16 UTSW 7 44140786 missense probably benign 0.03
R6589:Klk1b16 UTSW 7 44141470 missense probably benign 0.03
R7084:Klk1b16 UTSW 7 44139486 missense probably benign 0.01
R7336:Klk1b16 UTSW 7 44141483 missense probably benign 0.05
X0026:Klk1b16 UTSW 7 44140944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAGTGGGTACAACGAGGC -3'
(R):5'- TCTGTGAGCAAGGACTGTG -3'

Sequencing Primer
(F):5'- ATTCCACAGCCAGGATGGTG -3'
(R):5'- ACTGTGAGGGACCTGGCAG -3'
Posted On2016-07-06