Incidental Mutation 'R5231:Stat2'
ID 398538
Institutional Source Beutler Lab
Gene Symbol Stat2
Ensembl Gene ENSMUSG00000040033
Gene Name signal transducer and activator of transcription 2
Synonyms 1600010G07Rik
MMRRC Submission 042803-MU
Accession Numbers

Genbank: NM_019963.1; Ensembl: ENSMUST00000085708
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R5231 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 128270559-128292849 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 128281242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085708] [ENSMUST00000105238]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000085708
SMART Domains Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 138 314 5e-52 PFAM
Pfam:STAT_bind 316 564 1.2e-96 PFAM
SH2 576 652 4.71e-6 SMART
internal_repeat_1 750 778 6.35e-10 PROSPERO
internal_repeat_1 822 850 6.35e-10 PROSPERO
Pfam:STAT2_C 853 907 1.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105238
SMART Domains Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 141 314 2.6e-49 PFAM
Pfam:STAT_bind 316 564 1.5e-67 PFAM
SH2 577 653 4.71e-6 SMART
internal_repeat_1 751 779 6.69e-10 PROSPERO
internal_repeat_1 823 851 6.69e-10 PROSPERO
Pfam:STAT2_C 854 908 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220277
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4) Chemically induced(1)
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,951 H716L possibly damaging Het
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Bche G A 3: 73,700,861 P411S probably benign Het
Chil3 A G 3: 106,155,729 S182P probably damaging Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-53 C A 12: 115,158,605 S50I probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Klk1b16 T A 7: 44,137,347 L10Q probably damaging Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr1499 A T 19: 13,815,347 I81N probably damaging Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr394 C A 11: 73,887,955 C139F probably damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in Stat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Stat2 APN 10 128281176 missense probably benign 0.42
IGL02528:Stat2 APN 10 128290665 missense probably benign 0.07
IGL02859:Stat2 APN 10 128276611 missense probably damaging 1.00
IGL03119:Stat2 APN 10 128283517 missense probably benign 0.15
numb UTSW 10 128281065 splice site probably null
Paresthetic UTSW 10 128281242 critical splice donor site probably null
1mM(1):Stat2 UTSW 10 128277723 missense probably benign 0.06
R0098:Stat2 UTSW 10 128283262 missense probably damaging 1.00
R0334:Stat2 UTSW 10 128277867 missense probably damaging 1.00
R0496:Stat2 UTSW 10 128276509 missense probably benign 0.04
R1478:Stat2 UTSW 10 128282100 critical splice acceptor site probably null
R2857:Stat2 UTSW 10 128276901 splice site probably null
R3698:Stat2 UTSW 10 128278793 missense probably benign 0.30
R3870:Stat2 UTSW 10 128277893 missense probably benign 0.17
R5235:Stat2 UTSW 10 128291032 critical splice donor site probably null
R5264:Stat2 UTSW 10 128281065 splice site probably null
R5855:Stat2 UTSW 10 128283494 missense probably damaging 1.00
R6752:Stat2 UTSW 10 128283753 missense probably damaging 1.00
R7459:Stat2 UTSW 10 128276565 missense possibly damaging 0.95
R7467:Stat2 UTSW 10 128277903 splice site probably null
R7599:Stat2 UTSW 10 128277197 missense possibly damaging 0.45
R7756:Stat2 UTSW 10 128290728 small deletion probably benign
R7814:Stat2 UTSW 10 128290728 small deletion probably benign
R7992:Stat2 UTSW 10 128284962 missense probably damaging 1.00
R8335:Stat2 UTSW 10 128276583 missense possibly damaging 0.77
R8825:Stat2 UTSW 10 128291364 missense possibly damaging 0.70
R9052:Stat2 UTSW 10 128281669 missense probably damaging 1.00
R9104:Stat2 UTSW 10 128281242 critical splice donor site probably null
R9244:Stat2 UTSW 10 128282765 missense possibly damaging 0.93
R9405:Stat2 UTSW 10 128278765 missense probably damaging 0.99
R9433:Stat2 UTSW 10 128276788 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACTCTGTTACCCAGGTTGAC -3'
(R):5'- AGGTAGGAGCTGGCATACAC -3'

Sequencing Primer
(F):5'- TTGACGGCTGGAGCAAAGTTC -3'
(R):5'- GGCATACACAACCTTGTTCGG -3'
Posted On 2016-07-06