Incidental Mutation 'R5231:Olfr394'
ID398542
Institutional Source Beutler Lab
Gene Symbol Olfr394
Ensembl Gene ENSMUSG00000056921
Gene Nameolfactory receptor 394
SynonymsMOR135-8, GA_x6K02T2P1NL-4043306-4042374
MMRRC Submission 042803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5231 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73883337-73890771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73887955 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 139 (C139F)
Ref Sequence ENSEMBL: ENSMUSP00000149527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071478] [ENSMUST00000214284] [ENSMUST00000216608]
Predicted Effect probably damaging
Transcript: ENSMUST00000071478
AA Change: C139F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071415
Gene: ENSMUSG00000056921
AA Change: C139F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4e-7 PFAM
Pfam:7tm_1 39 288 1.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214284
AA Change: C139F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216608
AA Change: C139F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,951 H716L possibly damaging Het
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Bche G A 3: 73,700,861 P411S probably benign Het
Chil3 A G 3: 106,155,729 S182P probably damaging Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-53 C A 12: 115,158,605 S50I probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Klk1b16 T A 7: 44,137,347 L10Q probably damaging Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr1499 A T 19: 13,815,347 I81N probably damaging Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Stat2 T C 10: 128,281,242 probably null Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in Olfr394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr394 APN 11 73888249 missense probably damaging 1.00
IGL01655:Olfr394 APN 11 73887927 missense probably benign 0.01
IGL02173:Olfr394 APN 11 73888123 missense possibly damaging 0.72
IGL02308:Olfr394 APN 11 73888295 missense probably benign 0.09
IGL02656:Olfr394 APN 11 73888039 missense probably damaging 0.98
R0079:Olfr394 UTSW 11 73887737 missense probably benign 0.22
R0119:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0136:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0136:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0255:Olfr394 UTSW 11 73887829 missense probably benign
R0545:Olfr394 UTSW 11 73888017 nonsense probably null
R0599:Olfr394 UTSW 11 73887904 missense probably benign 0.19
R0655:Olfr394 UTSW 11 73887805 missense possibly damaging 0.88
R0657:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0657:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0720:Olfr394 UTSW 11 73887862 missense probably benign 0.12
R1112:Olfr394 UTSW 11 73888234 missense probably damaging 0.99
R2353:Olfr394 UTSW 11 73887834 missense probably benign 0.02
R2924:Olfr394 UTSW 11 73887511 missense probably damaging 0.99
R4583:Olfr394 UTSW 11 73887803 missense probably damaging 1.00
R5537:Olfr394 UTSW 11 73887697 missense probably benign 0.02
R5806:Olfr394 UTSW 11 73887547 missense probably damaging 0.99
R7131:Olfr394 UTSW 11 73887954 nonsense probably null
R7325:Olfr394 UTSW 11 73888275 missense probably benign 0.19
R7361:Olfr394 UTSW 11 73888001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAATGATGAGCCCTCCCATG -3'
(R):5'- GTCACAATGCCCAAATTGCTGC -3'

Sequencing Primer
(F):5'- TGATGAGCCCTCCCATGATAAGTATC -3'
(R):5'- GCCCAAATTGCTGCAGAATATG -3'
Posted On2016-07-06