Incidental Mutation 'R5231:Ighv1-53'
ID398550
Institutional Source Beutler Lab
Gene Symbol Ighv1-53
Ensembl Gene ENSMUSG00000093894
Gene Nameimmunoglobulin heavy variable 1-53
SynonymsAB069917, V23-D-J-C mu
MMRRC Submission 042803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5231 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location115158403-115158835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115158605 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 50 (S50I)
Ref Sequence ENSEMBL: ENSMUSP00000100304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103523]
Predicted Effect probably benign
Transcript: ENSMUST00000103523
AA Change: S50I

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100304
Gene: ENSMUSG00000093894
AA Change: S50I

DomainStartEndE-ValueType
IGv 36 117 3.52e-31 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,951 H716L possibly damaging Het
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Bche G A 3: 73,700,861 P411S probably benign Het
Chil3 A G 3: 106,155,729 S182P probably damaging Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Klk1b16 T A 7: 44,137,347 L10Q probably damaging Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr1499 A T 19: 13,815,347 I81N probably damaging Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr394 C A 11: 73,887,955 C139F probably damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Stat2 T C 10: 128,281,242 probably null Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in Ighv1-53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01815:Ighv1-53 APN 12 115158597 missense probably benign 0.01
IGL02326:Ighv1-53 APN 12 115158615 missense probably benign 0.21
BB010:Ighv1-53 UTSW 12 115158409 nonsense probably null
BB020:Ighv1-53 UTSW 12 115158409 nonsense probably null
R3404:Ighv1-53 UTSW 12 115158438 missense possibly damaging 0.81
R4020:Ighv1-53 UTSW 12 115158822 missense probably benign 0.00
R4169:Ighv1-53 UTSW 12 115158546 missense possibly damaging 0.63
R4241:Ighv1-53 UTSW 12 115158822 missense probably benign 0.00
R7139:Ighv1-53 UTSW 12 115158821 nonsense probably null
R7220:Ighv1-53 UTSW 12 115158515 missense probably benign 0.00
R7293:Ighv1-53 UTSW 12 115158821 nonsense probably null
R7933:Ighv1-53 UTSW 12 115158409 nonsense probably null
R7934:Ighv1-53 UTSW 12 115158616 nonsense probably null
R8846:Ighv1-53 UTSW 12 115158545 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGATGTGGTTGCAACACTG -3'
(R):5'- TCACAGTAGCAGGCTTGAGGTC -3'

Sequencing Primer
(F):5'- GTGTCTTGCACAATAATAGACCGCAG -3'
(R):5'- CAGGCTTGAGGTCTGGCCATATAC -3'
Posted On2016-07-06