Incidental Mutation 'R5237:Xylt2'
ID398554
Institutional Source Beutler Lab
Gene Symbol Xylt2
Ensembl Gene ENSMUSG00000020868
Gene Namexylosyltransferase II
SynonymsE030002B02Rik
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R5237 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94663851-94677515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94667127 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 638 (D638G)
Ref Sequence ENSEMBL: ENSMUSP00000112052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116349] [ENSMUST00000146693] [ENSMUST00000150377] [ENSMUST00000153485]
Predicted Effect probably benign
Transcript: ENSMUST00000116349
AA Change: D638G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112052
Gene: ENSMUSG00000020868
AA Change: D638G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.9e-60 PFAM
Pfam:Xylo_C 519 699 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146693
Predicted Effect probably benign
Transcript: ENSMUST00000150377
SMART Domains Protein: ENSMUSP00000134495
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
Pfam:Xylo_C 31 97 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153485
SMART Domains Protein: ENSMUSP00000122581
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.1e-59 PFAM
Pfam:Xylo_C 519 594 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154830
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isoform of xylosyltransferase, which belongs to a family of glycosyltransferases. This enzyme transfers xylose from UDP-xylose to specific serine residues of the core protein and initiates the biosynthesis of glycosaminoglycan chains in proteoglycans including chondroitin sulfate, heparan sulfate, heparin and dermatan sulfate. The enzyme activity, which is increased in scleroderma patients, is a diagnostic marker for the determination of sclerotic activity in systemic sclerosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele lack most liver proteoglycans and develop many aspects of polycystic liver and kidney disease, including biliary tract hyperplasia, liver fibrosis, biliary cysts, renal tubule dilation, basement membrane abnormalities and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Cog7 A G 7: 121,951,221 L360P probably damaging Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Galnt6 C A 15: 100,693,393 C610F probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Il15ra A G 2: 11,733,205 T250A possibly damaging Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Med24 T C 11: 98,710,783 Y524C probably damaging Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Mymk T C 2: 27,062,188 *181W probably null Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Serpina10 T A 12: 103,628,816 Y48F probably benign Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tesk1 T C 4: 43,447,100 F496S probably damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Xylt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02048:Xylt2 APN 11 94666345 missense possibly damaging 0.61
IGL02421:Xylt2 APN 11 94667762 missense possibly damaging 0.45
P0040:Xylt2 UTSW 11 94668791 missense possibly damaging 0.46
PIT4585001:Xylt2 UTSW 11 94666240 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0313:Xylt2 UTSW 11 94669894 splice site probably benign
R0449:Xylt2 UTSW 11 94666333 missense probably benign 0.22
R0511:Xylt2 UTSW 11 94669936 nonsense probably null
R1483:Xylt2 UTSW 11 94669567 missense probably benign 0.04
R1511:Xylt2 UTSW 11 94670433 missense probably damaging 1.00
R1565:Xylt2 UTSW 11 94667594 missense probably benign
R1616:Xylt2 UTSW 11 94668209 missense probably damaging 1.00
R1702:Xylt2 UTSW 11 94668745 missense probably damaging 0.98
R1712:Xylt2 UTSW 11 94668749 missense possibly damaging 0.88
R2233:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R2234:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R4534:Xylt2 UTSW 11 94666350 missense probably benign 0.02
R4702:Xylt2 UTSW 11 94669529 missense possibly damaging 0.83
R4768:Xylt2 UTSW 11 94670472 missense probably benign 0.06
R5032:Xylt2 UTSW 11 94670016 missense probably damaging 0.99
R5281:Xylt2 UTSW 11 94668790 missense probably benign 0.30
R5949:Xylt2 UTSW 11 94668483 missense probably damaging 1.00
R6950:Xylt2 UTSW 11 94667629 missense probably benign
R7041:Xylt2 UTSW 11 94667582 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGCTGTTATTGGCAAAGCAG -3'
(R):5'- TGGGACTCCAAGTGGTAGTG -3'

Sequencing Primer
(F):5'- AGAGCCCAGAGAGCCCAG -3'
(R):5'- ACTCCAAGTGGTAGTGGGTGC -3'
Posted On2016-07-06