Incidental Mutation 'R5237:Galnt6'
ID398579
Institutional Source Beutler Lab
Gene Symbol Galnt6
Ensembl Gene ENSMUSG00000037280
Gene Namepolypeptide N-acetylgalactosaminyltransferase 6
SynonymsGalNAc-T6
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R5237 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100691813-100729376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100693393 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 610 (C610F)
Ref Sequence ENSEMBL: ENSMUSP00000124793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052069] [ENSMUST00000159715] [ENSMUST00000161514]
Predicted Effect probably damaging
Transcript: ENSMUST00000052069
AA Change: C610F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056705
Gene: ENSMUSG00000037280
AA Change: C610F

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159715
AA Change: C610F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123848
Gene: ENSMUSG00000037280
AA Change: C610F

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 432 1e-10 PFAM
Pfam:Glycos_transf_2 180 366 4.1e-31 PFAM
Pfam:Glyco_transf_7C 337 415 6.7e-13 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160960
Predicted Effect probably damaging
Transcript: ENSMUST00000161514
AA Change: C610F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124793
Gene: ENSMUSG00000037280
AA Change: C610F

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229410
Meta Mutation Damage Score 0.9019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. The encoded protein is capable of glycosylating fibronectin peptide in vitro and is expressed in a fibroblast cell line, indicating that it may be involved in the synthesis of oncofetal fibronectin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Cog7 A G 7: 121,951,221 L360P probably damaging Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Il15ra A G 2: 11,733,205 T250A possibly damaging Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Med24 T C 11: 98,710,783 Y524C probably damaging Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Mymk T C 2: 27,062,188 *181W probably null Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Serpina10 T A 12: 103,628,816 Y48F probably benign Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tesk1 T C 4: 43,447,100 F496S probably damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Xylt2 T C 11: 94,667,127 D638G probably benign Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Galnt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Galnt6 APN 15 100703493 missense probably benign 0.16
IGL02606:Galnt6 APN 15 100714219 missense probably damaging 1.00
R0325:Galnt6 UTSW 15 100693471 splice site probably null
R0336:Galnt6 UTSW 15 100699206 missense probably damaging 0.99
R0504:Galnt6 UTSW 15 100696657 splice site probably benign
R1563:Galnt6 UTSW 15 100703378 missense probably benign 0.00
R1903:Galnt6 UTSW 15 100716118 missense possibly damaging 0.79
R2007:Galnt6 UTSW 15 100697166 missense probably damaging 1.00
R2114:Galnt6 UTSW 15 100714241 missense probably damaging 1.00
R2943:Galnt6 UTSW 15 100714279 splice site probably null
R3410:Galnt6 UTSW 15 100699137 missense probably damaging 1.00
R3954:Galnt6 UTSW 15 100697168 missense possibly damaging 0.72
R4754:Galnt6 UTSW 15 100699224 missense probably damaging 1.00
R4910:Galnt6 UTSW 15 100716178 missense probably benign
R4911:Galnt6 UTSW 15 100716178 missense probably benign
R4962:Galnt6 UTSW 15 100696574 nonsense probably null
R5293:Galnt6 UTSW 15 100703501 missense probably benign 0.00
R5605:Galnt6 UTSW 15 100697225 missense probably damaging 1.00
R5752:Galnt6 UTSW 15 100704126 missense probably damaging 1.00
R5837:Galnt6 UTSW 15 100694646 missense possibly damaging 0.70
R5949:Galnt6 UTSW 15 100696550 missense probably damaging 1.00
R6051:Galnt6 UTSW 15 100694668 missense probably damaging 1.00
R6306:Galnt6 UTSW 15 100693424 missense possibly damaging 0.70
R6522:Galnt6 UTSW 15 100693355 makesense probably null
R6959:Galnt6 UTSW 15 100714125 missense probably damaging 0.99
R7154:Galnt6 UTSW 15 100693464 missense probably benign 0.05
R7450:Galnt6 UTSW 15 100697815 missense probably damaging 1.00
R7834:Galnt6 UTSW 15 100714103 missense probably damaging 1.00
R7908:Galnt6 UTSW 15 100703361 missense probably damaging 1.00
R7917:Galnt6 UTSW 15 100714103 missense probably damaging 1.00
R7989:Galnt6 UTSW 15 100703361 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGAACATCCTGCCTTGGTG -3'
(R):5'- AGGCTAAAGCTGCTGTGTG -3'

Sequencing Primer
(F):5'- CCTTGGTGGCCACAGGG -3'
(R):5'- TCAGAATCAGAATCGGAATCGG -3'
Posted On2016-07-06